1 / 1

Genomic Sequencing of Chromosome 9: SET and NUP214 Genetic Variants

Explore genetic sequences delving into SET and NUP214 regions on chromosome 9 through genomic sequencing. Study mRNA variations, exon regions, and intronic details.

oralee
Download Presentation

Genomic Sequencing of Chromosome 9: SET and NUP214 Genetic Variants

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. chromosome 9 RP11-235f20 RP11-57C19 G248P8788C11 130.5 Mb 131.5 Mb 132.5 Mb 133.5 Mb SET CRAT ABL1 NUP214 del(9)(q34.11q34.13) mRNA SET Ex 7 NUP214 Ex 18 genomic sequencing: SET exon 8 UTR NUP214 intr. 17/18 SET aggaaagatgatgctcagttttaaacgttaaaagtgtacaagttgctttgtt |||||||||||||||||||||||||| LOUCY aggaaagatgatgctcagttttaaaccccctttttaattttggacacggtct |||||||||||||||||||||| NUP214 agctctgtttttttttttgttttgttttgttttttaattttggacacggtct SET ttctggtataaagctctcaaatgtgaccatgtgaatctgggtgggataatgg |||||||||||||||||||||||||| MEGAL ttctggtataaagctctcaaatgtgatttgtctccattacagttaattttat |||||||||||||||||||||||||| NUP214 aggtttagaattactttcagcaccgttttgtctccattacagttaattttat SET 3´region NUP214 intr. 17/18

More Related