Mendel’s Peas Part II

1. Mendel’s Peas Part II

2. Testcross and Backcross x Parents WW ww F1 x ww Ww Testcross Progeny ww Ww

3. Mendel and two genes Round Yellow Wrinkled Green x All F1 Round, Yellow Wrinkled Yellow 101 Wrinkled Green 32 Round Yellow 315 Round Green 108

4. Mendel and two genes Wrinkled Yellow 101 Wrinkled Green 32 Round Yellow 315 Round Green 108 Yellow = 416 Green = 140 Round = 423 Wrinkled = 133 Each gene has a 3 : 1 ratio.

5. Punnett Square

6. Ratio for a cross with 2 genes • Crosses with two genes are called dihybrid. • Dihybrid crosses have genetic ratios of 9:3:3:1.

7. Principle of Independent Assortment Ww Gg F1 Gametes & Frequencies wG ¼ wg ¼ WG ¼ Wg ¼ If a gamete contains W the probability that it contains G is equal to the probability that it contains g.

9. Phenotypes • W = Round • w = Wrinkled • W is dominant to w. • G = Yellow • g = Green • G is dominant to g.

10. F2 Progeny

11. Principle of Independent Assortment • Segregation of the members of any pair of alleles is independent of the segregation of other pairs in the formation of reproductive cells.

12. Summary of Mendel • Inherited traits are controlled by the alleles present in the reproductive cells that fuse to form the embryo. • In a diploid, progeny inherit one allele from the mother and one from the father. • Differences in the DNA sequence of two alleles for a gene may result in different phenotypes.

13. Summary • The phenotype is the same if the gene is inherited from the mother or from the father. • One allele from the diploid is inherited in each reproductive cell.

14. DNA • Hereditary material. • Contains all information to make proteins. • Linear polymer of nucleotide. • Each one has sugar, phosphate and a base.

15. Four Bases • A=Adenine • T=Thymine • C=Cytosine • G=Guanine

16. How Does DNA Carry Information? • To answer this question we must take a closer look at DNA. • DNA is a biopolymer • Polymers are molecules made of repeating units or building blocks • DNA has four chemical building blocks symbolized by the letters A,G,C,& T • The letters of your DNA are in a specific order that carries information about you!! • So, a DNA polymer can be represented as a string of letters: A G C T T A G G G T A A A C C C A T A T A

17. DNA Carries Information in the Sequence of DNA Letters . . .A G C T T A G G G T A A A C C C A T A G . . . A gene • A gene is a length of DNA letters that contain • an instruction for a cell to follow. • The cell uses specially designed protein machines • to read the information in genes.

18. The Order of DNA Letters Encodes the Genetic Information The order orsequenceof the A, G, C and T letters in the DNA polymer encodes the actual genetic information • Example of the DNA letters in a gene: • AGCTTAGGGTAAACCATATAGGGCCATACCCTATCGGTAAGCTT • AGCTTAGGGAAAACCCATATAGGGCCATACCCTATCGGTAAG • The specific order of the DNA letters carries • the information. • Changing the order of the DNA letters will change the information carried by the gene. • We will talk about how this happens later!

19. Genes Contain Instructions for Building Proteins • Genes contain instructions for making proteins, one of the major types of the molecules of life, or “biomolecules” • Proteins, like DNA, are polymers • Protein building blocks are called amino acids • Amino acids are strung together into long, linear polymers by following the instructions in genes • In general, a gene encodes the instructions for one protein • When a gene is “misspelled,” the protein made from it • may be made with an incorrect amino acid • may not work properly

20. Review of Gene Expression Pathway in Cells GENE DNA mRNA copy of gene mRNA goes to cytoplasm Ribosomes translate genetic information encoded in the mRNA into protein building blocks (chains of amino acids) Protein folds into 3D active structure Protein functions in cell Focus on the Genetic Code!

21. Genetic Code is Written in 3-Letter DNA Words (Codons) -TACCTCATGATTATACA- DNA(DNA strands separated) -AUGGAGUACUAAUAUGU mRNA (copied from DNA) 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA mRNA code “read” by ribosome in TANDEM triplets called codons. Codon adaptors convert RNA letters into the correct amino acid building blocks in the protein chain. • CODON MEANINGS: • A “START PROTEIN” SIGNAL:AUG • A “STOP PROTEIN” SIGNAL:UAA, UGA, UAG • An amino acid building blockof a protein • Codons identified in the Genetic Code Table

22. The Universal Genetic Code Table STOP Codons: UAA UAG UGA Name of Building Block Amino Acid: Phe=Phenylalanine Leu=Leucine Ile=Isoleucine AUG CODON: Signal to start making the protein. http://anx12.bio.uci.edu/~hudel/bs99a/lecture20/lecture1_6.html

23. N Met Glu Tyr C Genetic Code is Written in 3-Letter DNA Words -TACCTCATGATTATACA- DNA STRAND AUGGAGUACUAAUAUGU mRNA copied from DNA 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA Met-Glu-Tyr-STOP mRNA code is “read” in TANDEM CODONS A SHORT PROTEIN IS A PEPTIDE • CODON MEANINGS: • “START PROTEIN HERE”:AUG (START) Methionine (Met) • “STOP PROTEIN HERE”:UAA, UGA, UAG • Amino acid building blocks:N-Met-Glu-Tyr-C • Codons are identified in the Genetic Code Table

24. One Gene-One Protein • Archibald Garrod (1902) described alkaptonuria, a hereditary disorder as an “inborn error of metabolism”. • Proposed that mutations cause specific biochemical defects. • Alkaptonuria defect is dark urine.

25. Spelling Mistake The DNA “word” TTC is changed to TTT A DNA Spelling Mistake Can Alter the Protein Chain START ADD ADD ADD ADD ADD ADD ADD STOP ATG TTC AGG CCA AAT TTT GTC GCG UAA GGA ATT ATG TTT AGG CCA AAT TTT GTC GCG TTC to TTT spelling change causes a different protein building block to be inserted in the second position. That is all it takes. ADD = Codon specifies the amino acid specified by 3-letter “word” ATG/AUG = Codon specifies start and methionine (met) UAA = STOP adding amino acids to protein chain

26. A Mutation is a DNA “Spelling Mistake” • Mutant Genes Encode Defective Proteins: • (1)WILDTYPE(2)MUTANT • Example: AAA GCTACCTAT AAA GCTATCTAT • TTT CGATGGATA TTT CGATAGATA • Phe ArgTrp Ile Phe ArgStop • UAG • PROTEIN:WT FUNCTIONNO FUNCTION • (1) Normal DNA and amino acid sequence makes a wild-type protein. • (2) Mutation in DNA changesTrptoStop to make a short, mutant protein. • Mutations in DNA can be Caused by: • Mistakes made when the DNA is replicated (wrong base inserted) • Ultra violet (UV) light and ionizing radiation (X-rays) damage DNA • Environmental chemical carcinogens can damage DNA • Other factors DNA Technology: The Awesome Skill, I E Alcamo, Harcourt Academic Press, 2001

27. Cell may not be able to follow damaged instruction OR Damaged protein is made OR Spelling error may be harmless X X Damaged protein may or may not be able to function in the cell. Cell does not make the protein Functional protein made by the cell Misspelled Genes: 3 Possible Outcomes DNA A misspelled gene

28. Mutants across organisms • Sometimes mutations in the same gene in different organisms have similar phenotype. • This allows researchers to choose the organism with the best genetic resources to study the normal function of that gene.

29. Xeroderma pigmentosa • Autosomal recessive • UV exposure damages DNA • Defect in DNA damage repair • Risks include caner, telangiectasia, disfigurement • Can be diagnosed before birth • Treatment is total protection from sun/flourescent light.

30. UV damages tissue that contains molecules that can absorb light.

31. Mechanisms of UV damage • Molecular fragmentation—proteins, enzymes, and nucleic acids contain double bonds that can be ruptured by UV. • Free radical generation—molecules of susceptible tissues absorb UV and eject an electron which is taken up by oxygen, then termed super oxide, a free-radical.

32. Free radicals • Are scavanged by superoxide dismutase, vitamin C, vitamin E, glutathione peroxidase, carotene

33. Xeroderma pigmentosa

34. Lesion mutant in maize