DNA It’s not just for college anymore! - PowerPoint PPT Presentation

omer
dna it s not just for college anymore l.
Skip this Video
Loading SlideShow in 5 Seconds..
DNA It’s not just for college anymore! PowerPoint Presentation
Download Presentation
DNA It’s not just for college anymore!

play fullscreen
1 / 30
Download Presentation
DNA It’s not just for college anymore!
384 Views
Download Presentation

DNA It’s not just for college anymore!

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. DNAIt’s not just for college anymore!

  2. Web Sites • DNA structure and replication animation • Overview of gene expression • DNA Models & Translation model http://207.207.4.198/pub/flash/24/menu.swf http://www.genomicseducation.ca/animations/gene_expression.asp http://www.indigo.com/models/dna-models.html

  3. Learning Goals for DNA & Genetics • Know structure/function of DNA • Know DNA is genetic material • Illustrate how DNA specifies traits • Understand mutations are change in DNA sequence • Understand relationship between mutations in DNA and expressed phenotype

  4. What Is DNA • Deoxyribonucleic acid • Everyone knows this? • Molecule of heredity • Constitutes our genes • Genes are stretches of DNA sequence • DNA is present in each cell • Passed on to gametes and into progeny

  5. What is DNA, Really • Polymer of nucleotides • Polymer? Nucleotides? • Polymer • A large molecule that is a series of joined smaller molecules • Nucleotides • The small molecules that make up the large DNA polymer

  6. DNA Concepts • Genes • Chromosomes • Complementary base-paired double helix • Polymer of nucleotides • The sequence of nucleotides is the information of DNA

  7. DNA Concepts • DNA controls traits of organism • Traits pass from parent to offspring • DNA is copied during cell division • DNA is present in sex cells • DNA is passed from parent to offspring

  8. Why are DNA Concepts Difficult? • Chemical names? • Deoxyadenosine, purine, pyrimidine • Chemical processes? • base pairing, hydrogen bonds • Genetic principles? • DNA replication • Mutations • Chromosome segregation & assortment

  9. Why is DNA So Difficult? • Chemical Names • Deoxyadenosine monophosphate • Pyrimidine • Persons Names • Martina Navratilova • Hakeem Olajuwon

  10. How About Pictures + Names C B A E __ Hakeem Olajuwon __ Purine __ Kareem Abdul-Jabbar __ Deoxyadenosine monophosphate __ Pyrimidine __ Martina Navratilova __ Deoxycytidine monophosphate __ Nadia Comaneci F C H E B D G D A F G H

  11. NucleotidesThe building blocks of DNA

  12. Base always attached here Phosphates are attached there Nucleotide Structure

  13. Nucleotides Adenosine monophosphate Cytidine monophosphate Guanosine monophosphate Uridine monophosphate Deoxyadenosine monophosphate Deoxycytidine monophosphate Deoxyguanosine monophosphate Deoxythymidine monophosphate

  14. Nucleotide Polymerization Reaction: Phosphodiester Bond Formation

  15. AGTCCGATCGTAACTGGGTCACATCGTAAGTGTACACGTA |||||||||||||||||||||||||||||||||||||||| TCAGGCTAGCATTGACCCAGTGTAGCATTCACATGTGCAT Order of Nucleotides • As nucleotides join the strand they generate a sequence • Inherent fidelity of DNA replication TAAGTGTACACGTA ATTCACATGTGCAT TAAGTGTACACGTA TCACATCG TAAGTGTACACGTA TCACATCG TCACATCG TCACATCG TAAGTGTACACGTA AGTCCGATCGTAACTGGG |||||||||||||||||||||| |||||||||||||||||| AGTGTAGC ATTCACATGTGCAT TCAGGCTAGCATTGACCC AGTGTAGC AGTGTAGC ATTCACATGTGCAT TAAGTGTACACGTA ATTCACATGTGCAT

  16. DNA Sequence • Human Genome Project • sequencing the human genome • What does “sequencing” mean? • To determine the order of the nucleotides in the human DNA molecules • Human DNA molecules are our chromosomes • Each chromosome is a DNA double helix • Each DNA double helix is two single DNA molecules intertwined • Each single DNA molecule is a chain of nucleotide units • Sequencing is the method to determine what the exact order of units is in this chain

  17. DNA Gene Transcription RNA (messenger RNA) Translation Protein (sequence of amino acids) Functioning of proteins within living cells influences an organism’s traits. Gene Expression

  18. A Gene is a Transcription Unit Promoter & Regulatory sequences Terminator Coding sequences DNA Transcription mRNA 5¢ 3¢ Open reading frame Start codon Stop codon Ribosome binding site

  19. Transcription Coding

  20. A C Overview of gene expression

  21. Translation

  22. TranslationElongation aa-tRNA entry Peptidyl transferase Termination Translocation

  23. Translation

  24. a b b c The code is 3 letter words, but what about punctuation? GROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW • Code written in three letter words - codons • Ribosomes must start at the right place to read the message • There are three frames, but only one is read to give an intelligible message • Need a start codon (NOW) and a stop codon (END) to define the frame to use • frame b • NOW THE CAT SAW THE DOG BUT DID NOT RUN

  25. ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW a b c ^ ROWNDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW a b c Reading Frames & Mutation Types • Frame shift mutations • Original reading frame is frame a • Insertions or deletions shift the reading frame

  26. ROWANDNOWTHECATSAWTHEADOGBUTDIDNOTRUNENDSEW a b c Reading Frames & Mutations ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW a b c • Once a ribosome begins translation in a particular frame (a) it does not shift frames • Therefore, if a mutation shifts the reading frame in the mRNA, the ribosome will read the wrong frame. ^ NOW THE CAT SAW THE ADO GBU TDI DNO TRU NEN DSE W..

  27. ROWANDNOWTHECATSAWTHEDOGBUTENDNOTRUNENDSEW a Reading Frames & Mutations ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW a • A change that creates a stop codon is a non-sense mutation • Generates a truncated protein ^ ^ NOW THE CAT SAW THE DOG BUT END

  28. ^ ROWANDNOWTHECATSAWTHEHOGBUTDIDNOTRUNENDSEW a Reading Frames & Mutations ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW a • A change that creates a different codon is a mis-sense mutation • Generates a protein with an altered sequence NOW THE CAT SAW THE HOG BUT DID NOT RUN END

  29. Molecular Basis of Phenotype

  30. Effect of Mutations • Sickle cell disease • single nucleotide change AT