dna it s not just for college anymore l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
DNA It’s not just for college anymore! PowerPoint Presentation
Download Presentation
DNA It’s not just for college anymore!

Loading in 2 Seconds...

play fullscreen
1 / 30

DNA It’s not just for college anymore! - PowerPoint PPT Presentation


  • 378 Views
  • Uploaded on

DNA It’s not just for college anymore! Web Sites DNA structure and replication animation Overview of gene expression DNA Models & Translation model http://207.207.4.198/pub/flash/24/menu.swf http://www.genomicseducation.ca/animations/gene_expression.asp

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

DNA It’s not just for college anymore!


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
web sites
Web Sites
  • DNA structure and replication animation
  • Overview of gene expression
  • DNA Models & Translation model

http://207.207.4.198/pub/flash/24/menu.swf

http://www.genomicseducation.ca/animations/gene_expression.asp

http://www.indigo.com/models/dna-models.html

learning goals for dna genetics
Learning Goals for DNA & Genetics
  • Know structure/function of DNA
  • Know DNA is genetic material
  • Illustrate how DNA specifies traits
  • Understand mutations are change in DNA sequence
  • Understand relationship between mutations in DNA and expressed phenotype
what is dna
What Is DNA
  • Deoxyribonucleic acid
    • Everyone knows this?
  • Molecule of heredity
    • Constitutes our genes
    • Genes are stretches of DNA sequence
    • DNA is present in each cell
    • Passed on to gametes and into progeny
what is dna really
What is DNA, Really
  • Polymer of nucleotides
  • Polymer? Nucleotides?
  • Polymer
    • A large molecule that is a series of joined smaller molecules
  • Nucleotides
    • The small molecules that make up the large DNA polymer
dna concepts
DNA Concepts
  • Genes
  • Chromosomes
  • Complementary base-paired double helix
  • Polymer of nucleotides
  • The sequence of nucleotides is the information of DNA
dna concepts7
DNA Concepts
  • DNA controls traits of organism
  • Traits pass from parent to offspring
  • DNA is copied during cell division
  • DNA is present in sex cells
  • DNA is passed from parent to offspring
why are dna concepts difficult
Why are DNA Concepts Difficult?
  • Chemical names?
    • Deoxyadenosine, purine, pyrimidine
  • Chemical processes?
    • base pairing, hydrogen bonds
  • Genetic principles?
    • DNA replication
    • Mutations
    • Chromosome segregation & assortment
why is dna so difficult
Why is DNA So Difficult?
  • Chemical Names
    • Deoxyadenosine monophosphate
    • Pyrimidine
  • Persons Names
    • Martina Navratilova
    • Hakeem Olajuwon
how about pictures names
How About Pictures + Names

C

B

A

E

__ Hakeem Olajuwon

__ Purine

__ Kareem Abdul-Jabbar

__ Deoxyadenosine monophosphate

__ Pyrimidine

__ Martina Navratilova

__ Deoxycytidine monophosphate

__ Nadia Comaneci

F

C

H

E

B

D

G

D

A

F

G

H

nucleotides
Nucleotides

Adenosine monophosphate

Cytidine monophosphate

Guanosine monophosphate

Uridine monophosphate

Deoxyadenosine monophosphate

Deoxycytidine monophosphate

Deoxyguanosine monophosphate

Deoxythymidine monophosphate

order of nucleotides

AGTCCGATCGTAACTGGGTCACATCGTAAGTGTACACGTA

||||||||||||||||||||||||||||||||||||||||

TCAGGCTAGCATTGACCCAGTGTAGCATTCACATGTGCAT

Order of Nucleotides
  • As nucleotides join the strand they generate a sequence
  • Inherent fidelity of DNA replication

TAAGTGTACACGTA

ATTCACATGTGCAT

TAAGTGTACACGTA

TCACATCG

TAAGTGTACACGTA

TCACATCG

TCACATCG

TCACATCG

TAAGTGTACACGTA

AGTCCGATCGTAACTGGG

||||||||||||||||||||||

||||||||||||||||||

AGTGTAGC

ATTCACATGTGCAT

TCAGGCTAGCATTGACCC

AGTGTAGC

AGTGTAGC

ATTCACATGTGCAT

TAAGTGTACACGTA

ATTCACATGTGCAT

dna sequence
DNA Sequence
  • Human Genome Project
    • sequencing the human genome
  • What does “sequencing” mean?
    • To determine the order of the nucleotides in the human DNA molecules
    • Human DNA molecules are our chromosomes
    • Each chromosome is a DNA double helix
    • Each DNA double helix is two single DNA molecules intertwined
    • Each single DNA molecule is a chain of nucleotide units
    • Sequencing is the method to determine what the exact order of units is in this chain
gene expression

DNA

Gene

Transcription

RNA (messenger RNA)

Translation

Protein

(sequence of

amino acids)

Functioning of proteins within living

cells influences an organism’s traits.

Gene Expression
a gene is a transcription unit
A Gene is a Transcription Unit

Promoter & Regulatory

sequences

Terminator

Coding sequences

DNA

Transcription

mRNA 5¢

Open reading frame

Start

codon

Stop

codon

Ribosome binding site

translation elongation
TranslationElongation

aa-tRNA entry

Peptidyl transferase

Termination

Translocation

the code is 3 letter words but what about punctuation

a

b

b

c

The code is 3 letter words, but what about punctuation?

GROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW

  • Code written in three letter words - codons
  • Ribosomes must start at the right place to read the message
  • There are three frames, but only one is read to give an intelligible message
  • Need a start codon (NOW) and a stop codon (END) to define the frame to use
  • frame b
    • NOW THE CAT SAW THE DOG BUT DID NOT RUN
reading frames mutation types

ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW

a

b

c

^

ROWNDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW

a

b

c

Reading Frames & Mutation Types
  • Frame shift mutations
    • Original reading frame is frame a
    • Insertions or deletions shift the reading frame
reading frames mutations

ROWANDNOWTHECATSAWTHEADOGBUTDIDNOTRUNENDSEW

a

b

c

Reading Frames & Mutations

ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW

a

b

c

  • Once a ribosome begins translation in a particular frame (a) it does not shift frames
  • Therefore, if a mutation shifts the reading frame in the mRNA, the ribosome will read the wrong frame.

^

NOW THE CAT SAW THE ADO GBU TDI DNO TRU NEN DSE W..

reading frames mutations27

ROWANDNOWTHECATSAWTHEDOGBUTENDNOTRUNENDSEW

a

Reading Frames & Mutations

ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW

a

  • A change that creates a stop codon is a non-sense mutation
  • Generates a truncated protein

^

^

NOW THE CAT SAW THE DOG BUT END

reading frames mutations28

^

ROWANDNOWTHECATSAWTHEHOGBUTDIDNOTRUNENDSEW

a

Reading Frames & Mutations

ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW

a

  • A change that creates a different codon is a mis-sense mutation
  • Generates a protein with an altered sequence

NOW THE CAT SAW THE HOG BUT DID NOT RUN END

effect of mutations
Effect of Mutations
  • Sickle cell disease
    • single nucleotide change AT