Annotation and Alignment of the Drosophila Genomes
1 / 55

Annotation and Alignment of the Drosophila Genomes Centro de Ciencas Genomicas, May 29, 2006. - PowerPoint PPT Presentation

  • Uploaded on

Annotation and Alignment of the Drosophila Genomes Centro de Ciencas Genomicas, May 29, 2006. Genes or Regulation ?. “10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura / melanogaster divergence”

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about 'Annotation and Alignment of the Drosophila Genomes Centro de Ciencas Genomicas, May 29, 2006.' - nura

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

Annotation and Alignment of the Drosophila Genomes

Centro de Ciencas Genomicas, May 29, 2006.

Genes or regulation
Genes or Regulation?

  • “10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence”

  • “Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible”

Richards et al., Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution, Genome Res., Jan 2005.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

BP England, U Heberlein, R Tjian. Purified Drosophila transcription factor, Adh distal factor-1 (Adf-1), binds to sites in several Drosophila promoters and activates transcription, J Biol Chem 1990.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

Genes or regulatory elements
Genes annotation with GeneMapper, in press. or Regulatory Elements?

  • “10,516 10,867 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence”

  • “Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible”

Richards et al., Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution, Genome Res., Jan 2005.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

Alignment of coding sequence annotation with GeneMapper, in press.







DroYak_1_ GTCGCTCAGCCAGCATTTGCAGAAGTCGCAGAACTTCCGCTCGTTTGACTTCCAGTACTC ****** * ****** ** ** ** ***** **** ** ** ** ** ****** * **

Alignment of non-coding sequence






DroAna_20041206_ AATC-----ACTTAC


DroMoj_20041206_ ----TATTTACTCAC

DroPse_1_ ------TGTACTTAC


DroVir_20041029_ ----TATTTACTCAC


*** **

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

Alignment of coding sequence annotation with GeneMapper, in press.







DroYak_1_ GTCGCTCAGCCAGCATTTGCAGAAGTCGCAGAACTTCCGCTCGTTTGACTTCCAGTACTC ****** * ****** ** ** ** ***** **** ** ** ** ** ****** * **

Alignment of non-coding sequence

droAna1.2448876 CTGAAGGAATTCTA--TATTAAAG-------------------------------







*** * * * *

droAna1.2448876 AAGATTTCTCATCATTGGTTGAATC---------------------ACTTAC

dm2.chr2L -----------------------------------------TATGGACTCAC

droMoj1.contig_2959 -------------------------AAATATTT--------TATTGACTCAC

dp3.chr4_group3 -----------------------------------------TGT--ACTTAC

droSim1.chr2L -----------------------------------------TATGGACTCAC

droVir1.scaffold_6 ---------------------------------AAATATTTGGTCCACTCAC

droYak1.chr2L -----------------------------------------CATAAACTCAC

*** **

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006












Grun et al. microRNA target predictions across seven Drosophila species and comparison to mammalian targets, PloS Computational Biology, June 2005

Lall et al. A genome wide map of conserved microRNA targets in C. Elegans, Current Biology, February 2006

Example of a conserved microRNA target

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

Richards et al., Comparative genome sequencing of annotation with GeneMapper, in press.Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution, Genome Res., Jan 2005.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

How is an alignment made from two sequences? annotation with GeneMapper, in press.

Given two sequences of lengths n,m:











dp3.chr4_group3 TGT--ACTTAC

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006




dp3.chr4_group3 TGT--ACTTAC




DroPse_1_ ------TGTACTTAC

Each alignment can be summarized by counting the number of matches (#M), mismatches (#X), gaps (#G), and spaces (#S).

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006


#M=27, #X=18, #G=3, #S=28




dp3.chr4_group3 TGT--ACTTAC




DroPse_1_ ------TGTACTTAC

Each alignment can be summarized by counting the number of matches (#M), mismatches (#X), gaps (#G), and spaces (#S).

2(#M+#X)+#S=112 so #X,#G and #S suffice to specify a summary.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

The summary of an alignment is a point in 3 dimensional space.

For example, the two alignments just shown correspond to the points:

(22,3,12) (18,3,28)

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

The summary of an alignment is a point in 3 dimensional space.

For example, the two alignments just shown correspond to the points:

(22,3,12) (18,3,28)

In the example of our two sequences there are


different alignments.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

The summary of an alignment is a point in 3 dimensional space.

For example, the two alignments just shown correspond to the points:

(22,3,12) (18,3,28)

In the example of our two sequences there are


different alignments, but only


different summaries. So we don’t need to plot that many points.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

The summary of an alignment is a point in 3 dimensional space.

For example, the two alignments just shown correspond to the points:

(22,3,12) (18,3,28)

In the example of our two sequences there are


different alignments, but only


different summaries. So we don’t need to plot that many points.

But 53890 is still quite a large number. Fortunately, there are only 69 vertices on the convex hull of the 53890 points.

These are the interesting ones, and we can even draw them…

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

49 #x=24, #S=10, #G=2 space.

There are eight alignments that have this summary.







For the sequences:

the alignment polytope is:

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

















Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006



Consensus at a vertex

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006


The vertices of the polytope have special significance.

Given parameters for a model, e.g. the default parameters for MULTIZ:

M = 100,

X = -100,

S = -30,

G = -400

the summary is the result of maximizing the linear form


over the polytope.

Thus, the vertices of the polytope correspond to optimalalignments.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006


What is usually done, is that a single set of parameters is specified (M = 100, X = -100, S = -30, G = -400 is a standard default) and then theoptimal vertex is identified using dynamic programming. An alignment optimal for the vertex is then selected. The running time of the algorithm is O(nm) [Needleman-Wunsch, 1970, Smith-Waterman, 1981] and it requires O(n+m) space [Hirschberg 1975] .

Standard scoring schemes are:

Parameters Model

M,X,S Jukes-Cantor with linear gap penalty

M,X,S,GJukes-Cantor with affine gap penalty

M,XTS,XTV,S,GKimura-2 parameter with affine gap penalty

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

Building CTGCGGGATTAGGGGTCATTAGAGT===------===GCCGAAAAGCGAGTTTATTCTA=TGGACDrosophila whole genome multiple alignments





    (currently no D. erecta)

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006






DroAna_20041206_ AATC-----ACTTAC


DroMoj_20041206_ ----TATTTACTCAC

DroPse_1_ ------TGTACTTAC


DroVir_20041029_ ----TATTTACTCAC


*** **


N. Bray and L. Pachter, MAVID: Constrained ancestral alignment of multiple sequences, Genome Research 14 (2004) p 693--699

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006


Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

droAna1.2448876 CTGAAGGAATTCTA--TATTAAAG-------------------------------







*** * * * *

droAna1.2448876 AAGATTTCTCATCATTGGTTGAATC---------------------ACTTAC

dm2.chr2L -----------------------------------------TATGGACTCAC

droMoj1.contig_2959 -------------------------AAATATTT--------TATTGACTCAC

dp3.chr4_group3 -----------------------------------------TGT--ACTTAC

droSim1.chr2L -----------------------------------------TATGGACTCAC

droVir1.scaffold_6 ---------------------------------AAATATTTGGTCCACTCAC

droYak1.chr2L -----------------------------------------CATAAACTCAC

*** **


Blanchette et al., Aligning multiple sequences with the threaded blockset aligner, Genome Research 14 (2004) p 708--715

One possibly wrong alignment is not enough the history of parametric inference
One (possibly wrong) alignment is not enough: the history of parametric inference

  • 1992: Waterman, M., Eggert, M. & Lander, E.

    • Parametric sequence comparisons, Proc. Natl. Acad. Sci. USA89, 6090-6093

  • 1994: Gusfield, D., Balasubramanian, K. & Naor, D.

    • Parametric optimization of sequence alignment, Algorithmica12, 312-326.

  • 2003: Wang, L., Zhao, J.

    • Parametric alignment of ordered trees, Bioinformatics, 19 2237-2245.

  • 2004: Fernández-Baca, D., Seppäläinen, T. & Slutzki, G.

    • Parametric Multiple Sequence Alignment and Phylogeny Construction, Journal of Discrete Algorithms, 2 271-287.


by Kristian Stevens and Dan Gusfield

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006
Whole Genome Parametric Alignment parametric inferenceColin Dewey, Peter Huggins, Lior Pachter, Bernd Sturmfels and Kevin Woods

  • Mathematics and Computer Science

  • Parametric alignment in higher dimensions.

  • Faster new algorithms.

  • Deeper understanding of alignment polytopes.

  • Biology

  • Whole genome parametric alignment.

  • Biological implications of alignment parameters.

  • Alignment with biology rather than for biology.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006
Whole Genome Parametric Alignment parametric inferenceColin Dewey, Peter Huggins, Lior Pachter, Bernd Sturmfels and Kevin Woods

  • Mathematics and Computer Science

  • Parametric alignment in higher dimensions.

  • Faster new algorithms.

  • Deeper understanding of alignment polytopes.

  • Biology

  • Whole genome parametric alignment.

  • Biological implications of alignment parameters.









Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006
Whole Genome Parametric Alignment parametric inferenceColin Dewey, Peter Huggins, Lior Pachter, Bernd Sturmfels and Kevin Woods

  • Mathematics and Computer Science

  • Parametric alignment in higher dimensions.

  • Faster new algorithms.

  • Deeper understanding of alignment polytopes.

  • Biology

  • Whole genome parametric alignment.

  • Biological implications of alignment parameters.









Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

computational geometry parametric inference

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

= parametric inference


A Whole Genome Parametric Alignment of

D. Melanogaster and D. Pseudoobscura

  • Divided the genomes into 1,116,792 constrained and 877,982 unconstrained segment pairs.

  • 2d, 3d, 4d, and 5d alignment polytopes were constructed for each of the 877,802 unconstrained segment pairs.

  • Computed the Minkowski sum of the 877,802 2d polytopes.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

A Whole Genome Parametric Alignment of parametric inference

D. Melanogaster and D. Pseudoobscura

  • Divided the genomes into 1,116,792 constrained and 877,982 unconstrained segment pairs.

  • This is an orthology map of the two genomes.

  • 2d, 3d, 4d, and 5d alignment polytopes were constructed for each of the 877,802 unconstrained segment pairs.

  • For each segment pair, obtain all possible optimal summaries for all parameters in a Needleman--Wunsch scoring scheme.

  • Computed the Minkowski sum of the 877,802 2d polytopes.

  • There are only 838 optimal alignments of the two Drosophila genomes if the same match, mismatch and gap parameters are used for all the segment pair alignments.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

>mel parametric inference







How do we build the polytope for

Alignment polytopes are small
Alignment polytopes are small parametric inference

Theorem: The number of vertices of an alignment polytope for two sequences of length n and m is O((n+m)d(d-1)/(d+1)) where d is the number of free parameters in the scoring scheme.


Parameters Model Vertices

M,X,SJukes-Cantor with linear gap penalty O(n+m)2/3

M,X,S,GJukes-Cantor with affine gap penalty O(n+m)3/2M,XTS,XTV,S,GK2P with affine gap penalty O(n+m)12/5

L. Pachter and B. Sturmfels, Parametric inference for biological sequence analysis, Proceedings of the National Academy of Sciences, Volume 101, Number 46 (2004), p 16138--16143.

L. Pachter and B. Sturmfels, Tropical geometry of statistical models, Proceedings of the National Academy of Sciences, Volume 101, Number 46 (2004), p 16132--16137.

L. Pachter and B. Sturmfels (eds.), Algebraic Statistics for Computational Biology, Cambridge University Press.

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

Back to Adf1 parametric inference

BP England, U Heberlein, R Tjian. Purified Drosophila transcription factor, Adh distal factor-1 (Adf-1), binds to sites in several Drosophila promoters and activates transcription, J Biol Chem 1990.

Back to adf1
Back to Adf1 parametric inference


pse TGT-----------------GACTGCG

*** ** ***

BLASTZ alignment

Back to adf11
Back to Adf1 parametric inference


pse TGT-----------------GACTGCG

*** ** ***



**** ** * ** * ****** ** *** * **

Back to adf12
Back to Adf1 parametric inference


pse TGT-----------------GACTGCG

*** ** ***



**** ** * ** * ****** ** *** * **



**** * ** *** * ** *****

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

80.4% parametric inference

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

85.1% parametric inference

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

86.5% parametric inference

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

79.1% parametric inference

Applications parametric inference

  • Conservation of cis-regulatory elements

  • Phylogenetics: branch length estimation

Jukes-Cantor correction:

This is the expected number of mutations per site in an alignment with summary (x,s).

Applications parametric inference

  • Conservation of cis-regulatory elements

  • Phylogenetics: branch length estimation

Annotation and alignment of the drosophila genomes centro de ciencas genomicas may 29 2006

  • Algebraic Statistics parametric inference

  • -- A language for unifying and developing many of the algorithms for biological sequence analysis --

    • The few inference functions theorem

    • Polytope propagation

    • Phylogenetic tree reconstruction

    • Evolutionary models

    • Maximum likelihood estimation

    • Mutagenic tree models