fig 16 12b n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Fig. 16-12b PowerPoint Presentation
Download Presentation
Fig. 16-12b

Loading in 2 Seconds...

play fullscreen
1 / 43

Fig. 16-12b - PowerPoint PPT Presentation


  • 103 Views
  • Uploaded on

Eukaryotic replication. Origin of replication. Double - stranded DNA molecule. Parental (template ) strand. Daughter (new ) strand. Fig. 16-12b. 0.25 µm. Replication fork. Bubble. Two daughter DNA molecules. ( b ) Origins of replication in eukaryotes. 5 .

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Fig. 16-12b' - norah


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
fig 16 12b

Eukaryotic replication

Origin of replication

Double-stranded DNA molecule

Parental (template) strand

Daughter (new) strand

Fig. 16-12b

0.25 µm

Replication fork

Bubble

Two daughter DNA molecules

(b) Origins of replication in eukaryotes

fig 16 19

5

Ends of parental DNA strands

Leading strand

Lagging strand

3

Last fragment

Previous fragment

RNA primer

Lagging strand

5

Fig. 16-19

3

Parental strand

Removal of primers and replacement with DNA where a 3 end is available

5

3

Second round of replication

5

New leading strand

3

5

New lagging strand

3

Further rounds of replication

Shorter and shorter daughter molecules

fig 16 191

5

Ends of parental DNA strands

Leading strand

Lagging strand

3

Last fragment

Previous fragment

RNA primer

Lagging strand

5

Fig. 16-19

3

Parental strand

Removal of primers and replacement with DNA where a 3 end is available

5

3

Second round of replication

5

New leading strand

3

5

New lagging strand

3

Further rounds of replication

Shorter and shorter daughter molecules

fig 16 20

Staining of telomeres

Florescence In Situ Hybridization (FISH)

Fig. 16-20

1 µm

“probe” = (5’-CTAACC-3’)100

fig 16 7a

5 end

Hydrogen bond

3 end

1 nm

3.4 nm

Fig. 16-7a

3 end

0.34 nm

5 end

(a) Key features of DNA structure

(b) Partial chemical structure

fig 16 21a

Fig. 16-21a

Nucleosome

(10 nm in diameter)

DNA double helix (2 nm in diameter)

H1

Histone tail

Histones

DNA, the double helix

Histones

Nucleosomes, or “beads on a string” (10-nm fiber)

fig 16 21b

Chromatid

(700 nm)

30-nm fiber

Fig. 16-21b

Loops

Scaffold

300-nm fiber

Replicated chromosome (1,400 nm)

30-nm fiber

Looped domains (300-nm fiber)

Metaphase chromosome

slide9

What are genes?

DNA

How do genes work?

Mutant phenotypes

Short

aristae

Cinnabar

eyes

Vestigial

wings

Brown

eyes

Black

body

0

48.5

57.5

67.0

104.5

slide10

What are genes?

DNA

How do genes work?

A gene specifies the action of an enzyme

(The “one-gene, one-enzyme” hypothesis)

1909- Garrod

-“Inborn errors of metabolism in man”

e.g. Alkaptonuria: presence of alkapton in urine due to lack of enzyme

-underappreciated at the time….

1942- Beadle and Tatum

- Genetic studies in Bread Mold (Neurospora) show that biochemical reactions are controlled by genes

slide11

Wild type Neurospora grows on minimal media

Complete media

(contains amino acids, nucleotides, vitamins, etc.)

Minimal Media

(lacks amino acids, nucleotides, vitamins, etc.)

slide12

A

wt

B

Complete media

  • X-rays
  • Set up 1000 multiple single spore cultures (in complete media)

C

slide13

A

A

Min. media

wt

B

B

Complete media

Min. media

Complete media

  • X-rays
  • Set up 1000 multiple single spore cultures (in complete media)
  • Test each for growth on minimal media

C

C

Min. media

Minimal Media

slide14

A

A

A

A

A

A

A

A

Min. media

Min. media

Min. media

Min. media

Min. media

Min. media

Min. media

+Lys

+Val

+Arg

+Phe

+Trp

+His

+Leu

A

A

A

A

A

A

A

  • X-rays
  • Set up 1000 multiple single spore cultures (in complete media)
  • Test each for growth on minimal media
  • Retest on minimal media plus one component

Min. media

Min. media

Min. media

Min. media

Min. media

Min. media

Min. media

+Gln

+Cys

+Asn

+Gly

+Tyr

+Asp

+Glu

A

A

A

A

A

A

Min. media

Min. media

Min. media

Min. media

Min. media

Min. media

+Ile

+Met

+Pro

+Ala

+Ser

+Thr

fig 17 2c

Multiple enzymes are required for argininebiosynthesis

CONCLUSION

Class Imutants

(mutation in

gene A)

Class IImutants

(mutation in

gene B)

Class IIImutants

(mutation in

gene C)

Wild type

Fig. 17-2c

Precursor

Precursor

Precursor

Precursor

Gene A

Enzyme A

Enzyme A

Enzyme A

Enzyme A

Ornithine

Ornithine

Ornithine

Ornithine

Gene B

Enzyme B

Enzyme B

Enzyme B

Enzyme B

Citrulline

Citrulline

Citrulline

Citrulline

Gene C

Enzyme C

Enzyme C

Enzyme C

Enzyme C

Arginine

Arginine

Arginine

Arginine

fig 17 2c1

Multiple enzymes are required for argininebiosynthesis

CONCLUSION

Class Imutants

(mutation in

gene A)

Class IImutants

(mutation in

gene B)

Class IIImutants

(mutation in

gene C)

Wild type

Fig. 17-2c

Precursor

Precursor

Precursor

Precursor

Gene A

Enzyme A

Enzyme A

Enzyme A

Enzyme A

Ornithine

Ornithine

Ornithine

Ornithine

Gene B

Enzyme B

Enzyme B

Enzyme B

Enzyme B

Citrulline

Citrulline

Citrulline

Citrulline

Gene C

Enzyme C

Enzyme C

Enzyme C

Enzyme C

Arginine

Arginine

Arginine

Arginine

If we have an Argrequiring mutant, which gene is affected?

fig 17 2b

RESULTS

Classes of Neurospora crassa

Wild type

Class IIImutants

Class Imutants

Class IImutants

Minimal

medium

(MM)

(control)

Fig. 17-2b

MM +

ornithine

Condition

MM +

citrulline

MM +

arginine

(control)

fig 17 2c2

CONCLUSION

Class Imutants

(mutation in

gene A)

Class IImutants

(mutation in

gene B)

Class IIImutants

(mutation in

gene C)

Wild type

Fig. 17-2c

Precursor

Precursor

Precursor

Precursor

Gene A

Enzyme A

Enzyme A

Enzyme A

Enzyme A

Ornithine

Ornithine

Ornithine

Ornithine

Gene B

Enzyme B

Enzyme B

Enzyme B

Enzyme B

Citrulline

Citrulline

Citrulline

Citrulline

Gene C

Enzyme C

Enzyme C

Enzyme C

Enzyme C

Arginine

Arginine

Arginine

Arginine

slide19

DNA

Protein

RNA

Replication

Transcription

Translation

fig 17 3a 1

Fig. 17-3a-1

DNA

TRANSCRIPTION

mRNA

(a) Bacterial cell

fig 17 3a 2

Fig. 17-3a-2

DNA

TRANSCRIPTION

mRNA

Ribosome

TRANSLATION

Polypeptide

(a) Bacterial cell

slide22

E. Coli LacZ DNA sequence (1 strand shown)- 3075 base pairs

ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGCTGGAGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGACTACACAAATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGGTCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCTGAACGTCGAAAACCCGAAACTGTGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGACGGCACGCTGATTGAAGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGCTGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGATGAGCAGACGATGGTGCAGGATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAACCATCCGCTGTGGTACACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACGGCATGGTGCCAATGAATCGTCTGACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGGTGCAGCGCGATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAATCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATATTATTTGCCCGATGTACGCGCGCGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCGCTGATCCTTTGCGAATACGCCCACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAGTATCCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTAAATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCGAACGATCGCCAGTTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAAACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAGCGAATACCTGTTCCGTCATAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCTCTGGATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGGGCAACTCTGGCTCACAGTACGCGTAGTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGGCACATCAGCGCCTGGCAGCAGTGGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCATCTGACCACCAGCGAAATGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTTCACAGATGTGGATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGCTGGATAACGACATTGGCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGCCGAAGCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGATGCGGTGCTGATTACGACCGCTCACGCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCGATACACCGCATCCGGCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGCGCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAA

slide23

E. Coli LacZ RNA sequence - 3075 nucleotides

AUGACCAUGAUUACGGAUUCACUGGCCGUCGUUUUACAACGUCGUGACUGGGAAAACCCUGGCGUUACCCAACUUAAUCGCCUUGCAGCACAUCCCCCUUUCGCCAGCUGGCGUAAUAGCGAAGAGGCCCGCACCGAUCGCCCUUCCCAACAGUUGCGCAGCCUGAAUGGCGAAUGGCGCUUUGCCUGGUUUCCGGCACCAGAAGCGGUGCCGGAAAGCUGGCUGGAGUGCGAUCUUCCUGAGGCCGAUACUGUCGUCGUCCCCUCAAACUGGCAGAUGCACGGUUACGAUGCGCCCAUCUACACCAACGUGACCUAUCCCAUUACGGUCAAUCCGCCGUUUGUUCCCACGGAGAAUCCGACGGGUUGUUACUCGCUCACAUUUAAUGUUGAUGAAAGCUGGCUACAGGAAGGCCAGACGCGAAUUAUUUUUGAUGGCGUUAACUCGGCGUUUCAUCUGUGGUGCAACGGGCGCUGGGUCGGUUACGGCCAGGACAGUCGUUUGCCGUCUGAAUUUGACCUGAGCGCAUUUUUACGCGCCGGAGAAAACCGCCUCGCGGUGAUGGUGCUGCGCUGGAGUGACGGCAGUUAUCUGGAAGAUCAGGAUAUGUGGCGGAUGAGCGGCAUUUUCCGUGACGUCUCGUUGCUGCAUAAACCGACUACACAAAUCAGCGAUUUCCAUGUUGCCACUCGCUUUAAUGAUGAUUUCAGCCGCGCUGUACUGGAGGCUGAAGUUCAGAUGUGCGGCGAGUUGCGUGACUACCUACGGGUAACAGUUUCUUUAUGGCAGGGUGAAACGCAGGUCGCCAGCGGCACCGCGCCUUUCGGCGGUGAAAUUAUCGAUGAGCGUGGUGGUUAUGCCGAUCGCGUCACACUACGUCUGAACGUCGAAAACCCGAAACUGUGGAGCGCCGAAAUCCCGAAUCUCUAUCGUGCGGUGGUUGAACUGCACACCGCCGACGGCACGCUGAUUGAAGCAGAAGCCUGCGAUGUCGGUUUCCGCGAGGUGCGGAUUGAAAAUGGUCUGCUGCUGCUGAACGGCAAGCCGUUGCUGAUUCGAGGCGUUAACCGUCACGAGCAUCAUCCUCUGCAUGGUCAGGUCAUGGAUGAGCAGACGAUGGUGCAGGAUAUCCUGCUGAUGAAGCAGAACAACUUUAACGCCGUGCGCUGUUCGCAUUAUCCGAACCAUCCGCUGUGGUACACGCUGUGCGACCGCUACGGCCUGUAUGUGGUGGAUGAAGCCAAUAUUGAAACCCACGGCAUGGUGCCAAUGAAUCGUCUGACCGAUGAUCCGCGCUGGCUACCGGCGAUGAGCGAACGCGUAACGCGAAUGGUGCAGCGCGAUCGUAAUCACCCGAGUGUGAUCAUCUGGUCGCUGGGGAAUGAAUCAGGCCACGGCGCUAAUCACGACGCGCUGUAUCGCUGGAUCAAAUCUGUCGAUCCUUCCCGCCCGGUGCAGUAUGAAGGCGGCGGAGCCGACACCACGGCCACCGAUAUUAUUUGCCCGAUGUACGCGCGCGUGGAUGAAGACCAGCCCUUCCCGGCUGUGCCGAAAUGGUCCAUCAAAAAAUGGCUUUCGCUACCUGGAGAGACGCGCCCGCUGAUCCUUUGCGAAUACGCCCACGCGAUGGGUAACAGUCUUGGCGGUUUCGCUAAAUACUGGCAGGCGUUUCGUCAGUAUCCCCGUUUACAGGGCGGCUUCGUCUGGGACUGGGUGGAUCAGUCGCUGAUUAAAUAUGAUGAAAACGGCAACCCGUGGUCGGCUUACGGCGGUGAUUUUGGCGAUACGCCGAACGAUCGCCAGUUCUGUAUGAACGGUCUGGUCUUUGCCGACCGCACGCCGCAUCCAGCGCUGACGGAAGCAAAACACCAGCAGCAGUUUUUCCAGUUCCGUUUAUCCGGGCAAACCAUCGAAGUGACCAGCGAAUACCUGUUCCGUCAUAGCGAUAACGAGCUCCUGCACUGGAUGGUGGCGCUGGAUGGUAAGCCGCUGGCAAGCGGUGAAGUGCCUCUGGAUGUCGCUCCACAAGGUAAACAGUUGAUUGAACUGCCUGAACUACCGCAGCCGGAGAGCGCCGGGCAACUCUGGCUCACAGUACGCGUAGUGCAACCGAACGCGACCGCAUGGUCAGAAGCCGGGCACAUCAGCGCCUGGCAGCAGUGGCGUCUGGCGGAAAACCUCAGUGUGACGCUCCCCGCCGCGUCCCACGCCAUCCCGCAUCUGACCACCAGCGAAAUGGAUUUUUGCAUCGAGCUGGGUAAUAAGCGUUGGCAAUUUAACCGCCAGUCAGGCUUUCUUUCACAGAUGUGGAUUGGCGAUAAAAAACAACUGCUGACGCCGCUGCGCGAUCAGUUCACCCGUGCACCGCUGGAUAACGACAUUGGCGUAAGUGAAGCGACCCGCAUUGACCCUAACGCCUGGGUCGAACGCUGGAAGGCGGCGGGCCAUUACCAGGCCGAAGCAGCGUUGUUGCAGUGCACGGCAGAUACACUUGCUGAUGCGGUGCUGAUUACGACCGCUCACGCGUGGCAGCAUCAGGGGAAAACCUUAUUUAUCAGCCGGAAAACCUACCGGAUUGAUGGUAGUGGUCAAAUGGCGAUUACCGUUGAUGUUGAAGUGGCGAGCGAUACACCGCAUCCGGCGCGGAUUGGCCUGAACUGCCAGCUGGCGCAGGUAGCAGAGCGGGUAAACUGGCUCGGAUUAGGGCCGCAAGAAAACUAUCCCGACCGCCUUACUGCCGCCUGUUUUGACCGCUGGGAUCUGCCAUUGUCAGACAUGUAUACCCCGUACGUCUUCCCGAGCGAAAACGGUCUGCGCUGCGGGACGCGCGAAUUGAAUUAUGGCCCACACCAGUGGCGCGGCGACUUCCAGUUCAACAUCAGCCGCUACAGUCAACAGCAACUGAUGGAAACCAGCCAUCGCCAUCUGCUGCACGCGGAAGAAGGCACAUGGCUGAAUAUCGACGGUUUCCAUAUGGGGAUUGGUGGCGACGACUCCUGGAGCCCGUCAGUAUCGGCGGAAUUCCAGCUGAGCGCCGGUCGCUACCAUUACCAGUUGGUCUGGUGUCAAAAAUAA

slide24

E. Coli LacZ protein sequence – 1024 amino acids

MTMITDSLAVVLQRRDWENPGVTQLNRLAAHPPFASWRNSEEARTDRPSQQLRSLNGEWRFAWFPAPEAVPESWLECDLPEADTVVVPSNWQMHGYDAPIYTNVTYPITVNPPFVPTENPTGCYSLTFNVDESWLQEGQTRIIFDGVNSAFHLWCNGRWVGYGQDSRLPSEFDLSAFLRAGENRLAVMVLRWSDGSYLEDQDMWRMSGIFRDVSLLHKPTTQISDFHVATRFNDDFSRAVLEAEVQMCGELRDYLRVTVSLWQGETQVASGTAPFGGEIIDERGGYADRVTLRLNVENPKLWSAEIPNLYRAVVELHTADGTLIEAEACDVGFREVRIENGLLLLNGKPLLIRGVNRHEHHPLHGQVMDEQTMVQDILLMKQNNFNAVRCSHYPNHPLWYTLCDRYGLYVVDEANIETHGMVPMNRLTDDPRWLPAMSERVTRMVQRDRNHPSVIIWSLGNESGHGANHDALYRWIKSVDPSRPVQYEGGGADTTATDIICPMYARVDEDQPFPAVPKWSIKKWLSLPGETRPLILCEYAHAMGNSLGGFAKYWQAFRQYPRLQGGFVWDWVDQSLIKYDENGNPWSAYGGDFGDTPNDRQFCMNGLVFADRTPHPALTEAKHQQQFFQFRLSGQTIEVTSEYLFRHSDNELLHWMVALDGKPLASGEVPLDVAPQGKQLIELPELPQPESAGQLWLTVRVVQPNATAWSEAGHISAWQQWRLAENLSVTLPAASHAIPHLTTSEMDFCIELGNKRWQFNRQSGFLSQMWIGDKKQLLTPLRDQFTRAPLDNDIGVSEATRIDPNAWVERWKAAGHYQAEAALLQCTADTLADAVLITTAHAWQHQGKTLFISRKTYRIDGSGQMAITVDVEVASDTPHPARIGLNCQLAQVAERVNWLGLGPQENYPDRLTAACFDRWDLPLSDMYTPYVFPSENGLRCGTRELNYGPHQWRGDFQFNISRYSQQQLMETSHRHLLHAEEGTWLNIDGFHMGIGGDDSWSPSVSAEFQLSAGRYHYQLVWCQK

fig 17 5

Fig. 17-5

Second mRNA base

First mRNA base (5 end of codon)

Third mRNA base (3 end of codon)

slide26

LacZ (Beta-galactosidase) gene (DNA)

Beta-galactosidase protein (E. coli)

LacZ mRNA

slide27

E. Coli Sliding Clamp DNA sequence (1 strand shown)- 1101 base pairs

ATGAAATTTACCGTAGAACGTGAGCATTTATTAAAACCGCTACAACAGGTGAGCGGTCCGTTAGGTGGTCGTCCTACGCTACCGATTCTCGGTAATCTGCTGTTACAGGTTGCTGACGGTACGTTGTCGCTGACCGGTACTGATCTCGAGATGGAAATGGTGGCACGTGTTGCGCTGGTTCAGCCACACGAGCCAGGAGCGACGACCGTTCCGGCGCGCAAATTCTTTGATATCTGCCGTGGTCTGCCTGAAGGCGCGGAAATTGCCGTGCAGCTGGAAGGTGAACGGATGCTGGTACGCTCCGGGCGTAGCCGTTTTTCGCTGTCTACCCTGCCAGCGGCGGATTTCCCGAACCTCGATGACTGGCAGAGTGAAGTCGAATTTACCCTGCCGCAGGCAACGATGAAGCGTCTGATTGAAGCGACCCAGTTTTCTATGGCGCATCAGGACGTTCGCTATTACTTAAATGGTATGCTGTTTGAAACCGAAGGTGAAGAACTGCGCACCGTGGCAACCGACGGCCACCGTCTGGCGGTCTGTTCAATGCCAATTGGTCAATCTTTGCCAAGCCATTCGGTGATCGTACCGCGTAAAGGCGTGATTGAACTGATGCGTATGCTCGACGGCGGCGACAATCCGCTGCGCGTACAGATTGGCAGCAACAACATTCGCGCCCACGTTGGCGACTTTATCTTCACCTCCAAACTGGTGGATGGTCGCTTCCCGGATTATCGCCGCGTTCTGCCGAAGAACCCGGACAAACATCTGGAAGCTGGCTGCGATCTGCTCAAGCAGGCGTTTGCTCGCGCGGCGATTCTCTCTAACGAGAAATTCCGCGGCGTACGTCTTTATGTCAGCGAAAACCAGCTGAAAATCACCGCCAACAACCCGGAACAGGAAGAAGCGGAAGAGATCCTCGACGTTACCTATAGCGGTGCGGAGATGGAAATCGGCTTCAACGTCAGTTATGTGCTGGATGTTCTGAACGCGCTGAAATGCGAAAACGTCCGCATGATGCTGACCGATTCGGTTTCCAGCGTGCAGATTGAAGATGCGGCCAGCCAGAGCGCGGCTTATGTTGTCATGCCAATGAGACTGTAA

E. Coli Sliding Clamp Protein sequence- 366 amino acids

MKFTVEREHLLKPLQQVSGPLGGRPTLPILGNLLLQVADGTLSLTGTDLEMEMVARVALVQPHEPGATTVPARKFFDICRGLPEGAEIAVQLEGERMLVRSGRSRFSLSTLPAADFPNLDDWQSEVEFTLPQATMKRLIEATQFSMAHQDVRYYLNGMLFETEGEELRTVATDGHRLAVCSMPIGQSLPSHSVIVPRKGVIELMRMLDGGDNPLRVQIGSNNIRAHVGDFIFTSKLVDGRFPDYRRVLPKNPDKHLEAGCDLLKQAFARAAILSNEKFRGVRLYVSENQLKITANNPEQEEAEEILDVTYSGAEMEIGFNVSYVLDVLNALKCENVRMMLTDSVSSVQIEDAASQSAAYVVMPMRL

fig 16 15b

Origin of replication

3

5

RNA primer

5

Fig. 16-15b

“Sliding clamp”

3

5

DNA pol III

Parental DNA

3

5

5

3

5

fig 17 4

Gene 2

DNA

molecule

Gene 1

Gene 3

Fig. 17-4

DNA

template

strand

TRANSCRIPTION

mRNA

Codon

TRANSLATION

Protein

Amino acid

fig 5 27c 2

Sugars

Fig. 5-27c-2

Deoxyribose (in DNA)

Ribose (in RNA)

(c) Nucleoside components: sugars

fig 5 27c 1

Nitrogenous bases

Pyrimidines

Fig. 5-27c-1

Cytosine (C)

Thymine (T, in DNA)

Uracil (U, in RNA)

Purines

Adenine (A)

Guanine (G)

(c) Nucleoside components: nitrogenous bases

slide33

Fig. 16-5

Nitrogenous bases

Sugar–phosphate backbone 5 end

Chemical structure of DNA

Thymine (T)

Adenine (A)

Cytosine (C)

DNA nucleotide

Phosphate

Sugar (deoxyribose) 3 end

Guanine (G)

slide34

Fig. 16-5

Nitrogenous bases

Sugar–phosphate backbone 5 end

Chemical structure of

RNA

-ribose instead of deoxyribose

Uracilinstead of thymine

OH

OH

OH

OH

Thymine (T)

Uracil (U)

Cytosine (C)

Adenine (A)

Cytosine (C)

RNA

DNA nucleotide

Phosphate

Sugar (deoxyribose) 3 end

Guanine (G)

slide35

DNA

Protein

RNA

Replication

Transcription

Translation

Polymerase

DNA Pol III

(and I)

dNTPs

Monomers

Template

ssDNA

Direction of synthesis

5’ to 3’

polynucleotide

Product

slide36

DNA

Protein

RNA

Replication

Transcription

Translation

Polymerase

DNA Pol III

(and I)

RNA Pol

dNTPs

NTPs

Monomers

ssDNA

Template

ssDNA

5’ to 3’

Direction of synthesis

5’ to 3’

polynucleotide

polynucleotide

Product

fig 17 7a 1

Promoter

Transcription unit

5

3

3

5

DNA

Start point

RNA polymerase

Fig. 17-7a-1

fig 17 7a 2

Promoter

Transcription unit

5

3

3

5

DNA

Start point

RNA polymerase

Initiation

1

5

3

Fig. 17-7a-2

3

5

Template strand

of DNA

RNA

transcript

Unwound

DNA

fig 17 7a 3

Promoter

Transcription unit

5

3

3

5

DNA

Start point

RNA polymerase

Initiation

1

5

3

Fig. 17-7a-3

3

5

Template strand

of DNA

RNA

transcript

Unwound

DNA

Elongation

2

Rewound

DNA

5

3

3

3

5

5

RNA

transcript

fig 17 7a 4

Promoter

Transcription unit

5

3

3

5

DNA

Start point

RNA polymerase

Initiation

1

5

3

Fig. 17-7a-4

3

5

Template strand

of DNA

RNA

transcript

Unwound

DNA

Elongation

2

Rewound

DNA

5

3

3

3

5

5

RNA

transcript

Termination

3

5

3

3

5

3

5

Completed RNA transcript

slide41

Fig. 17-7b

Nontemplate

strand of DNA

Elongation

RNA nucleotides

RNA

polymerase

3'

3' end

5'

Direction of

transcription

(“downstream”)

5'

Template

strand of DNA

Newly made

RNA

fig 17 8

A eukaryotic promoter

includes a TATA box

1

Promoter

Template

5

3

3

5

TATA box

Template

DNA strand

Start point

Several transcription factors must

bind to the DNA before RNA

polymerase II can do so.

2

Fig. 17-8

Transcription

factors

5

3

3

5

Additional transcription factors bind to

the DNA along with RNA polymerase II,

forming the transcription initiation complex.

3

RNA polymerase II

Transcription factors

3

5

5

5

3

RNA transcript

Transcription initiation complex

slide43

DNA

Protein

RNA

Replication

Transcription

Translation

Polymerase

DNA Pol III

(and I)

RNA Pol

dNTPs

NTPs

Monomers

ssDNA

Template

ssDNA

5’ to 3’

Direction of synthesis

5’ to 3’

polynucleotide

polynucleotide

Product