GFP – LacZ alpha fusion presentation - PowerPoint PPT Presentation

nigel
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
GFP – LacZ alpha fusion presentation PowerPoint Presentation
Download Presentation
GFP – LacZ alpha fusion presentation

play fullscreen
1 / 16
Download Presentation
Presentation Description
217 Views
Download Presentation

GFP – LacZ alpha fusion presentation

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. GFP – LacZ alpha fusion presentation • Overview of work done • Questions I plan to answer [1] • Scope of work [1] • [1] Based upon discussion with Austin Che

  2. GFP – LacZ alpha fusion presentation • Overview of work done • Questions I plan to answer [1] • Scope of work [1] • [1] Based upon discussion with Austin Che

  3. Big picture : want dual reporter GFP ß-galactosidase (ß-gal) [1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.

  4. 1. Hwang et al GFP – full length LacZ fusion : Works Hwang et al (2006) C-terminal GFP (red) 11 AA linker LacZ monomer 1 (Brown) N-terminal LacZ (yellow) LacZ monomer 2 (Purple) LacZ sub-units (purple and brown) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

  5. 2. Austin Che GFP and N-terminal LacZ alpha fusion : Doesn’t work Bba_E0050 C-terminal GFP (red) No linker LacZ alpha (blue) N-terminal LacZ (yellow) LacZ – alpha fragment (blue) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)


  6. 3. Austin Che LacZ-alpha and N-terminal GFP fusion : Works Bba_E0051 N-terminal GFP (yellow) 18 AA linker C-terminal LacZ (red) LacZ – alpha fragment (blue) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

  7. 4. Austin Che LacZ-alpha and N-terminal GFP variants Bba_E0051 Have this with 12 promoter / RBS combinations LacZ – alpha fragment (blue) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

  8. GFP – LacZ alpha fusion presentation • Overview of work done • Questions I plan to answer [1] • Scope of work [1] • [1] Based upon discussion with Austin Che

  9. Questions • 1. Can E0051 be used to report promoter activity? • Scope of work • Receive E0051 from Austin • PCR with BBa sites on primers and with RBS on forward primer • Insert into flipee vector, downstream of promoter

  10. Questions • 2. Does re-designed E0050 fusion work? • Scope of work • Receive E0051 primer designs from Austin • Design primers for PCR of LacZ and GFP, with linker / RBS • PCR “stitch” to create E0050 with linker Bba_E0050 Insert linker

  11. Questions • 3. How d0 E0050 2.0, E0051, E0050, and full length fusion compare? • Scope of my work based upon discussions with Austin • Receive full length GFP fusion from Hwang group and E0050. • Compare performance of constructs.

  12. Questions • 4. Are GFP/lacZ activities correlated independent of promoter/RBS? • Scope of my work based upon discussions with Austin • Evaluate on microplate reader.

  13. Questions • Can E0051 be used to report promoter activity? • Does re-designed E0050 fusion work? • How d0 E0050 2.0, E0051, E0050, and full length fusion compare? • Are GFP/lacZ activities correlated independent of promoter/RBS? • Scope of work • Receive E0051, E0051, 12 E0051 variants, primer designs from Austin • Receive full length GFP fusion from Hwang group • PCR E0051 w/ BBa sites on primers and with RBS on forward primer • Insert into flipee vector, downstream of promoter, test • Design primers for PCR of LacZ and GFP, with linker / RBS • PCR “stitch” to create an E0050 with linker • Compare performance of E0050 2.0, E0051, E0050, Hwang fusion. • Evaluate promoter/RBS variants on microplate reader.

  14. Appendix I: Hwang et al

  15. 1. LacZ – GFP fusion : Hwang et al [1] show fusion protein between GFP and the N-terminal alpha fragment of full length lacZ + LacZ excised from pMC1817 by Pst1 MCS Pst1 LacZ GFP 11 amino acid linker EcoR1 TCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAG [1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.

  16. 1. LacZ – GFP fusion : It works [1] GFP ß-galactosidase (ß-gal) [1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.