1 / 26

To Degrade or Not to Degrade: Substrate Recognition by Lon Protease

To Degrade or Not to Degrade: Substrate Recognition by Lon Protease. Amy Dinh Department of Microbiology Mentor: Janine E. Trempy, Ph.D. Protein Misfolding Diseases. abnormal protein. normal protein. protein aggregate. Treatment Issues. Aggregates cause disease or caused by disease

neila
Download Presentation

To Degrade or Not to Degrade: Substrate Recognition by Lon Protease

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. To Degrade or Not to Degrade: Substrate Recognition by Lon Protease Amy Dinh Department of Microbiology Mentor: Janine E. Trempy, Ph.D.

  2. Protein Misfolding Diseases abnormalprotein normal protein protein aggregate

  3. Treatment Issues • Aggregates cause disease or caused by disease • Cause of abnormal proteins? • Result of malfunction of related protein? ADDL aggregates (yellow) coating a neuron in Alzheimer’s Disease. Scientific American

  4. Studying Human Lon with E. coli • lon • ATP dependent protease • highly conserved in evolution • four known substrates in E. coli • NO known substrates in humans

  5. Aims • Study how E. coli Lon interacts with its substrates • Help identify human Lon substrates • Substrates with effects on central nervous system • Identify relationship between CNS substrates and abnormal proteins

  6. Research Methods • E. coli Lon interactions with two substrates • RcsA • SulA • Control physiological effects • Clear phenotypes

  7. transcriptional activator of capsular polysaccharide genes (mucoidy) RcsA lon+ lon- RcsA intiates CPS transcription RcsA initiates CPS transcription Lon degrades RcsA RcsA not degraded Non-mucoid cell Mucoid cell

  8. SulA • SulA (SOS gene) • halts cell division • filament formation Cells exposed to MMS/UV SulA causes filament formation SulA degraded (lon+) SulA not degraded ((lon-) Filaments resolved into new cells Cell death

  9. Prior Research Proteolytic Binding Site SulA SulA Lon Lon RcsA RcsA Competition Hierarchy

  10. N-terminus velcro domain RcsA recognition Site Lon Domains SulA recognition Site? aa residue # 369 411 679 211-271 421 783 351 1 Met Ser C-terminus ATP Binding Site Proteolytic Bindng Site

  11. GCATTGCGGGGCTATCGGTCACACTGCATCGTCATCGAATCGGGCGCGCCCTGATTGA CGTAACGCCCCGATAGCCAGTGTGACGTAGCAGTAGCTTAGCCCGCGCGGGACTAACT Making Mutants • Mutagenesis • K11 and Tll strains • Contain antibiotic resistance gene linked to lon • methylating agent: nitrosoguanidine (NTG) • Generation of random point mutations

  12. 10 minutes lon Making Mutants • DNA Packaging • P1vir Lysates • P1vir Bacteriophage • ~100 kb (20 genes) 100/0 11 minutes Tetr / Kanr 45 75 50

  13. Making Mutants • Transduction • Infection of healthy E. coli with P1vir tetr/ kanr tetr/ kanr mutated lon mutated lon normal lon normal lon E.coli E.coli Infection P1 vir Recombination P1 vir

  14. Making Mutants • Requires several phases of screening • 1. Selection for mutations on lon • Mutant behavior re: RcsA

  15. 10 minutes lon Screening for Mutants • Limited DNA capacity 100/0 11 minutes Tetr / Kanr 45 75 50

  16. Screening for Mutants • Requires several phases of screening • 1. Selection for mutations on lon • Mutant behavior re: RcsA • 2. Screening using temperature selection

  17. Low temperatures Protein folding normal Wild type behavior High temperatures Abnormal protein folding Mutant behavior Temperature Selection Hypothesis Lon Lon

  18. Screening for Mutants • Requires several phases of screening • 1. Selection for mutations on lon • Mutant behavior re: RcsA • 2. Screening using temperature selection • 3. Screening using temperature selection and MMS • Mutant behavior re: SulA

  19. Normal cells Mutant Classes • I: Lon defective with RcsA Mucoid

  20. Mutant Classes • II: Lon defective with SulA NormalCell Filamentation/ Cell Death On MMS at 42º

  21. Mutant Classes • III: Lon defective with RcsA and SulA CellDeath Normal cells Mucoid On MMS at 42º

  22. Mutant Classes • IV: Lon Gone Wild NormalCell Cell Death At 42º

  23. Mutants Isolated • 8 Class I Mutants • Lon Defective with RcsA • 3 Class II Mutants • Lon Defective with SulA • Intermediate MMS sensitivity • 2 Class IV Mutants • Lon Gone Wild • Validates Temperature Selection Hypothesis

  24. Next Steps • Mutant Verification/Identification • Presence of Lon/RcsA/SulA • Western Blot • Amplify lon using PCR • Sequence DNA • Compare Mutant Sequence with E. coli lon sequence

  25. Why Bother? • Learn how Lon selects its substrates in E. coli • A model for Lon in humans • Help identify Lon substrates in humans • Understand more about age-related protein misfolding diseases

  26. Acknowledgements • Dr. Janine Trempy • Howard Hughes Medical Institute • HHMI Selection Committee • Undergraduate Research, Innovation, Scholarship and Creativity (URISC) Program • URISC Selection Committee

More Related