slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Viveca Giongo Laboratório de Virologia Molecular, Departamento de Biologia Celular e Molecular/UFF PowerPoint Presentation
Download Presentation
Viveca Giongo Laboratório de Virologia Molecular, Departamento de Biologia Celular e Molecular/UFF

Loading in 2 Seconds...

play fullscreen
1 / 53

Viveca Giongo Laboratório de Virologia Molecular, Departamento de Biologia Celular e Molecular/UFF - PowerPoint PPT Presentation


  • 106 Views
  • Uploaded on

Como a Reação em Cadeia da Polimerase (PCR), PCR em tempo real e o Sequenciamento de genes são ferramentas importantes na investigação científica e no diagnóstico laboratorial ?. Viveca Giongo Laboratório de Virologia Molecular, Departamento de Biologia Celular e Molecular/UFF.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Viveca Giongo Laboratório de Virologia Molecular, Departamento de Biologia Celular e Molecular/UFF' - naiya


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Como a Reação em Cadeia da Polimerase (PCR), PCR em tempo real e o Sequenciamento de genes são ferramentas importantes na investigação científica e no diagnóstico laboratorial ?

Viveca Giongo

Laboratório de Virologia Molecular,

Departamento de Biologia Celular e Molecular/UFF

par metros para valida o de um teste sorol gico
Parâmetros para validação de um teste sorológico
  • Sensibilidade - refere-se à porcentagem de resultados positivos pelo teste na população doente. Verdadeiros Positivos
  • Sensibilidade: VP/VP+FN
  • Especificidade - porcentagem de resultados negativos pelo teste em indivíduos não doentes. Proporção dos verdadeiros negativos
  • Especificidade: VN/ VN+FP
a sorologia sempre funciona
A Sorologia sempre funciona ?
  • Alguns cuidados: IgM representa infecção recente. Certo?
  • Ela pode permanecer na fase de convalescença
  • Não indica portanto infecção recente
  • Infecções fulminantes por vírus, infecções com risco de evolução maligna necessitam de um diagnostico precoce
slide7

Histórico...

Nobel Prize, 1968

Principio da replicação do DNA

Molecular Structure of Nucleic Acids: A Structure for Deoxyribose Nucleic Acid

J. D. WATSON & F. H. C. CRICK

Medical Research Council Unit for the Study of the Molecular Structure of Biological Systems, Cavendish Laboratory, Cambridge. April 2

Nature 171, 737-738 (25 April 1953) | doi:10.1038/171737a

thermus acquaticus
Thermus acquaticus

JOURNAL OF BACTERIOLOGY, Aug. 1969, p. 289-297 Vol. 98, No. I

Thermus aquaticus gen. n. and sp. n., a Nonsporulating Extreme Thermophile

THOMAS D. BROCK AND HUDSON FREEZE

Department of Microbiology, Indiana University, Bloomington, Indiana 47401

The isolation of a new thermophilic bacterium, Thermus aquaticus gen. n. And sp. n., is described. Successful enrichment requires incubation at 70 to 75 C, and the use of nutrient media relatively dilute with respect to the organic components.

Strains of T. aquaticus have been isolated from a variety of thermal springs in Yellowstone National Park and from a thermal spring in California. The organism has also been isolated from man-made thermal habitats, such as hot tap water, in geographical locations quite distant from thermal springs. Isolates of T. Aquaticus are gram-negative nonsporulating nonmotile rods which frequently form long filaments at supraoptimal temperatures or in the stationary phase. The optimum temperature for growth is 70 C, the maximum 79 C, and the minimum about 40 C. The generation time at the optimum is about 50 min.

quem inventou a pcr
Quem inventou a PCR

Kary Mullis, geneticista

Nobel Prize em Química (1993) pelo desenvolvimento de um método que permite sintetizar, em poucas horas e in vitro, uma grande quantidade de um determinado fragmento de DNA

Seus estudos em 1985 permitiram amplificar o DNA

Saiki, R., Scharf, S., Faloona, F., Mullis, K., Horn, G., and Erlich, H. (1985). Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: 1350-54

Mullis, K. and Faloona, F. (1987). Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 155: 335-35

slide12

"for contributions to the developments of methods within DNA-based chemistry: for his invention of the polymerase chain reaction (PCR) method"

slide13
PCR
  • Polymerase Chain Reaction (reação em cadeia da polimerase)
  • Reação enzimática de polimerização de DNA in vitro
  • É uma reação cíclica na qual os produtos de um ciclo são substratos para o ciclo seguinte
  • Amplificação de sequências específicas de DNA, permitindo sua visualização e/ou análise posterior
  • É um processo termodinâmico e enzimático
c pia molecular
Cópia molecular

Capaz de copiar e multiplicar parte de uma “sentença”

TACGCCGATCTCGTCCGACGCTAGTAACCGATCGGAAGGCCTAAGCATTTCGCGATGACCTAGGATCGATGCATTAAGCGTAGCTAGCATGAGGATAGGCTACGTACGTAGGTTACGCATGGATTAACAACCATAGCATGACTAGCTAGGATCACTGAGTACAGTACTAGACTACGTAGCTAGACTAGATGCATAGCTAGCAGTACTTGCATGACTGACTACGTAGCTAGCCGTTAGCTAACGTAGGTTACGCATGGATTAACAACCATAGCATGACTAGCTAGGATCACTGAGAAGCGTAGCTAGCATGAGGATAGGCTACGTACGTAGGTTACGCATGGATTAACAACCACTAGGATCGATGCATTAAGCGTAGCTAGCATGAGGATAGGCTACGTACGTAGGTTACGCATGGATTAACAACCATAGCATGACTAGCTAGGATCACTGAGTACTGAGGATAGGCTACGTACGTAGGTTACGCATGGATTAACAACCAACTAGCTAGGATCACTGAGTACAGTACTAGGCATATTAGTGCGTAGCTAGC

quais s o as aplica es da pcr
Quais são as aplicações da PCR?
  • Diagnósticos moleculares
  • Identificação e isolamento de genes
  • Marcadores moleculares
  • Expressão gênica
  • PCR em tempo real
aplica es
Aplicações
  • Teste de Identificação de indivíduos
  • polimorfismo
slide21

Aplicações expressão gênica e polimorfismo

Polimorfismo p53

MELANOMAS DE MUCOSA ORAL E CUTÂNEOS

elementos da pcr
Elementos da PCR

DNA amostra, DNA polimerase, Termociclador – substitui a helicase e

DNTP – nucleotideos trifosfatados

qual a import ncia de oligos ou primers bem desenhados
Qual a importância de oligos Ou primers bem desenhados?

Pré requisito para obter sucesso no PCR

* alta eficiência

* maior sensibilidade

* produtos de PCR especificos

* ausência de co-amplificação com DNA genômico

avalia o pr via da sequ ncia alvo
Avaliação prévia da sequência alvo

Observar:

* significado biológico (mRNA/cDNA x gDNA)

* sequência única

* qualidade da sequência alvo

* evitar regiões não desejadas na sequência alvo

etapas da pcr
Etapas da PCR

1. Desnaturação

2. Anelamento

3. Extensão

ao sair do termociclador a apar ncia a mesma revela o da regi o amplificada
Ao sair do termociclador a aparência é a mesma – revelação da região amplificada

http://teach.genetics.utah.edu/

quantifica o do dna amplificado
Quantificação do DNA amplificado

Nanodrop (espectofotômetro)  260 nm

trabalhando com pcr convencional
Trabalhando com PCR convencional

1. Etapas Pré- PCR:

Coleta da Amostra

Estabilização

Extração do Ácido Nucleico

2. PCR ou Ciclagem:

Preparo da Reação

Termociclagem

3. Pós-PCR:

Análise em Gel

tipos de pcr
Tipos de PCR

Hot Start

In situ

Inverse

Long

Multiplex

Nested

Competitive

Touchdown

Degenerate

Fast

hot start pcr
Hot Start PCR

A enzima DNA polimerase pode demonstrar uma pequena atividade à temperatura ambiente, durante a montagem do experimento

E isso pode catalisar a extensão da extremidade 3`

Levando depois a degradação da extremidade 5`pois a DNA pol possui atividade exonuclease

Destruindo o primer e o substrato

Hot Start permite a inibição da atividade da polimerase durante o preparo da reação

A polimerase esta ligada a anticorpos e não funciona a temperatura ambiente

O aumento da temperatura libera os ac monoclonais e a reação se inicia

in situ pcr ish
In situ PCR (ISH)

Reação de PCR que ocorre dentro da célula numa lâmina

Pode ser realizado em células ou tecidos fixados

Útil para acompanhar infecções

inverse pcr ipcr c
Inverse PCR (IPCR)c

DNA cortado em pequenos fragmentos por enzimas de restrição

Ligação do produto – DNA circular

DNA novamente tratado com enzimas de restrição – gera produtos com sequencia interna conhecida, que pode ser usada na PCR

PCR é realizada com primers complementares às sequências internas conhecidas

long pcr
Long PCR

PCR cuja extensão é mais longa que as PCR convencionais (> 5Kb)

Enzima amplifica alvos maiores (alta fidelidade!)

Objetivos:

- Clonagem de cDNA de longos transcritos

- Mapeamento de sequências

- PCR de genoma mitocondrial

multiplex pcr
Multiplex PCR

PCR com dois ou mais conjuntos de primers, para amplificação de diferentes fragmentos de uma mesma amostra

Objetivos:

- identificação de vários vírus

- identificação de deleções em genes em doenças degenerativas (Distrofia muscular de Duchenne)

nested pcr
Nested PCR

É uma variação da PCR convencional, na qual são utilizados dois paraes de primers (ao i nvés de um) para amplificar um mesmo fragmento

Duas PCR: primeira com a fita parental, em seguida em uma segunda PCR com a fita menor

Aumenta a especificidade!

competitive pcr
Competitive PCR

É adicionada a reação uma quantidade conhecida de um fragmento de DNA (competidor)

Esse competidor deve conter sequências para os mesmos primers utilizados para amplificar o alvo

Quantidade de Dna alvo pode ser derterminada pela razão Alvo (T) / competidor (C)

touchdown pcr
Touchdown PCR

Modificação da PCR convencional que pode resultar na diminuição de amplificações não especificas

Temperatura de anelamento

- começa mais alta que e temperatura ótima dos primers

- diminuição de 1C a cada um ou dois ciclos, até atingir a temperatura específica

- após atingir essa temperatura ela é mantida nos ciclos restantes

Objetivo:

Aumentar a especificidade, evita amplificação errônea

95C 30s

95C 30s, 60C 30 s, 72 C 1min (3 ciclos)

95C 30s, 56 C 30 s, 72 C 1min (3 ciclos)

95C 30s, 53 C 30 s, 72 C 1min (3 ciclos)

95C 30s, 50 C 30 s, 72 C 1min (25 ciclos)

72C 5 min

degenerate pcr
Degenerate PCR

O que são primers degenerados?

Primers que possuem um numero de opções em várias posições na sequência

Exemplo:

5´- TCGAATTCVCCYAAYTGRCCNT-3´

A+C+G =V

C+T= Y

A+C+G+T= N

Objetivo: avaliar polimorfismo

fast pcr
Fast PCR

Kits específicos (ex. GeneAmp Fast PCR Master Mix)

PCR pode ser realizado de forma mais rápida, para algumas aplicações, tais como:

- genotipagem de animais transgênicos

- PCR de colônia

limita es da pcr convencional
Limitações da PCR convencional

* Intensa padronização

* Baixa sensibilidade e resolução

* Curta extensão dinâmica (< 2 logs)

* Colorações não quantitativas

* Contaminação (brometo)

* Discriminação baseada soemnte no tamanho do amplicon

* Não automatizado

* Necessidade de pós processamento do produto da PCR

real time pcr with the sybr green i dye
Real-time PCR with the SYBR® Green I dye.

O corante torna-se fluorescente (diamantes verdes) quando se liga a dupla fita de DNA

real time pcr with taqman primers
Real-time PCR with TaqMan® primers

O corante torna-se fluorescente (diamantes verdes) quando se liga a dupla fita de DNA

hr 1 tm melt curve
HR-1TM Melt Curve

A única curva isolada ilustra um declínio mais rápido da fluorescência,indicando uma mutação que pode ter interrompido o pareamento de bases de nucleotídeos do DNA

slide53

http://www.youtube.com/watch?v=gNNI19l1LW8&feature=player_detailpagehttp://www.youtube.com/watch?v=gNNI19l1LW8&feature=player_detailpage

Em 1993, Kary Mullis, um geneticista ao serviço da Cetus, uma empresa de Biotecnologia da Califórnia, recebeu o prémio Nobel da Química pelo desenvolvimento de um método que permite sintetizar, em poucas horas e in vitro, uma grande quantidade de um determinado fragmento de DNA. Esta técnica faz parte integrante da moderna biotecnologia molecular, tendo trazido um enorme progresso a áreas como o diagnóstico de doenças, medicina forense entre muitas outras para além da Investigação em Biologia.

Kary Mullins ganhou o prêmio Nobel de química em 1993 por desenvolver o famoso PCR, Reação em Cadeia da Polimerase, que é um processo usado muito em labs de biologia molecular para multiplicar uma pequena quantidade de DNA em muito DNA, facilitando nosso trabalh

http://www.youtube.com/watch?v=gNNI19l1LW8&feature=player_detailpage