chromosome fusion l.
Skip this Video
Loading SlideShow in 5 Seconds..
CHROMOSOME FUSION? PowerPoint Presentation
Download Presentation

Loading in 2 Seconds...

play fullscreen
1 / 20

CHROMOSOME FUSION? - PowerPoint PPT Presentation

  • Uploaded on

CHROMOSOME FUSION?. WHAT IS MOST STRIKING HERE?. Compare the Banding Patterns: 6 longest chromosomes of humans ( Hu ) , are matched with 7 chromosomes from three ape species . WHY COLORED TIPS?. Why are the chromosome tips colored?. CHROMOSOME PARTS. Head Telomere.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about 'CHROMOSOME FUSION?' - naasir

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
what is most striking here

Compare the Banding Patterns:

6 longest chromosomes of humans (Hu),

are matched with 7 chromosomes from three ape species.

why colored tips

Why are the chromosome tips colored?

chromosome parts


All Chromosomes have telomeres at their ends(like shoelace aglets!)



Telomeres have a unique DNA sequence…




let s narrow our focus
Let’s Narrow Our Focus:

6 longest chromosomes of humans(Hu), matched with 7 chromosomes from chimpanzees ONLY (Ch)

more questions

Why are TWO shorter chimp chromosomes needed to matchour #2 chromosome?

Could our #2 chromosome have formed by the FUSION of TWO shorter chromosomes found in chimpanzees today (#12 and #13)? LIKE THIS…?













If fusion occurred, then we should see DNA evidence of the head-to-head telomeres together near middle of our #2 chromosome



Fusion Area?



DNA Sequence for Telomeres:






Tandem Repeats in Telomeres:




Repeated 800-1600 timesin each Telomere


  • What will you look for?
  • tandem repeats in fusion area
  • Where will you look for them?
  • middle of our chromosome #2
  • How can you look for them?
  • search online DNA database
  • What if evidence is NOT found?
  • fusion may not have happened
chromosome fusion11
  • Read the lesson
  • Do the lesson - Go online
  • Discuss the results
  • Explanation?

STOP HERECONTINUE ONLY AFTER DOING LESSONor if there’s no time to do the lesson

stop here

(Results follow)


108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg

108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg

108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg

108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc

108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg

108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt

108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta

108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt

108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc

108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc

108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct

108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta

108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca

108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc

108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac

108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac

109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa

109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct

109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg

109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc

109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc

109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

results clarified

108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg

108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg

108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg

108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc

108301 tgcattgcagggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg

108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt

108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta

108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt

108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc

108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc

108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct

108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta

108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca

108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc

108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac

108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac

109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa

109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct

109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg

109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc

109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc

109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg



See where the head-to-head fusion occurred?

why the sudden change

108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt

108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta

108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt

108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc

108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc

108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct

108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta



Why do the TANDEM REPEATS suddenly changefromttaggg to ccctaa?

Why so many slight variations in the number of t’s, a’s, g’s, and c’s in each repeat?

DO THE LESSON, and find out!

why so few repeats

108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc

108301 tgcattgcagggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg

108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt

108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta

108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt

108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc

108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc

108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct

108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta

108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca

108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc

108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac

108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac

109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa

109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct

109141 ccgcctttaa ggtgccccccaggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg



Count the TANDEM REPEATS in both telomere segments.

(only about 37 ttaggg repeats in Head 13; about 88 ccctaa repeats in Head 12)

Should be 800 to 1600 repeats, so…Why so many FEWER than typically found in telomeres?

DO THE LESSON and find out!

re check banding patterns
Re-Check Banding Patterns

Compare other chromosomes online: Human with Chimp, Dog…

multiple evidence
  • Compare hominoid chromosomes
  • Compare hominoid skulls
  • Study pattern of hominid chronology
  • Compare primate hemoglobins

What do ALL of these patterns suggest?