bioinformatics the application of computer science to biological data n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Bioinformatics The application of computer science to biological data PowerPoint Presentation
Download Presentation
Bioinformatics The application of computer science to biological data

Loading in 2 Seconds...

play fullscreen
1 / 31

Bioinformatics The application of computer science to biological data - PowerPoint PPT Presentation


  • 89 Views
  • Uploaded on

Bioinformatics The application of computer science to biological data. Tony C Smith Department of Computer Science University of Waikato tcs@cs.waikato.ac.nz. The essence is prediction …. My dog is very littl _ ?

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Bioinformatics The application of computer science to biological data' - morwen


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
bioinformatics the application of computer science to biological data

BioinformaticsThe application of computer science to biological data

Tony C Smith

Department of Computer Science

University of Waikato

tcs@cs.waikato.ac.nz

the essence is prediction
The essence is prediction …

My dog is very littl_ ?

  • We know that letters do not occur in English at random (e.g. ‘t’ is more common than ‘x’)
  • We know that context changes the probability of a letter (e.g. ‘x’ is more common than ‘t’ after the sequence “I eat Weet-Bi_”)

Predicting symbols is fundamental to a wide range of important applications (e.g. encryption, compression)

Bioinformatics Tony C Smith

prediction in bioinformatics
Prediction in bioinformatics
  • Predicting the location of genes in DNA
  • Predicting gene roles in an organism
  • Predicting errors in a genetic transcription
  • Predicting the function of proteins
  • Predicting diseases from molecular samples
  • Anything that involves “making a judgment”; a yes/no decision about whether some sample datum ‘does’ or ‘does not’ have some property.

Bioinformatics Tony C Smith

representation
Representation

W e e t – B i x

0101011101100101011001010111010000101101 …

… to the computer, everything is binary!

Bioinformatics Tony C Smith

slide5
0101011101100101011001010111010000101101

0101101100100111111011010011010000101101

A A C G T C A T T C G A T G A T T C G A

Just as we can teach a computer to predict things about a sequence of letters in English prose, we can also teach it to predict things about a other sequences—like a genetic sequence

Bioinformatics Tony C Smith

a genetic prediction problem
A genetic prediction problem

ttgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagc

Bioinformatics Tony C Smith

a genetic prediction problem1
A genetic prediction problem

ttgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagctgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgttgcgcacccacaccagttatatagagacgaactc

Bioinformatics Tony C Smith

a genetic prediction problem2
A genetic prediction problem

ttgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagctgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgttgcgcacccacaccagttatatagagacgaactcttgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagctgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgcaatcggcgctacgcttcaaaatttattatattcccggcgcggctacgttcatcccagcagcagcgattttaaaattaacgcatcagactctcgtcgcgttcgtcgcctttattcacgctaatggacgacatcttttactacgacggcgcctacgcatcgcagcatacgacgcccagcatagtattttagaggcgaggacatcatcatatcgcagctacagcgcatcagacgcatacgacgacgactacgacgacactaacgacgatgttgcgcacccacaccagttatatagagacgaactcgcatcagtgttgcgcacccacaccagttatatagagacgaactc

Bioinformatics Tony C Smith

a genetic prediction problem3
A genetic prediction problem
  • A gene encodes a protein
  • It is a blueprint that provides biochemical instructions on how to construct a sequence of amino acids so as to make a working protein that will perform some function in the organism

Bioinformatics Tony C Smith

a genetic prediction problem4

RNA

RNA

RNA

RNA

RNA

transcription

factor

A genetic prediction problem

untranslated region

encoding region

Bioinformatics Tony C Smith

a genetic prediction problem5
A genetic prediction problem

untranslated region

Bioinformatics Tony C Smith

a genetic prediction problem6
A genetic prediction problem

ttgcaatcggcgctacgcttcaaaatttattatattcccggc

untranslated region

Bioinformatics Tony C Smith

a genetic prediction problem7
A genetic prediction problem

ttgcaatcggcgctacgcttcaaaatttattatattcccggc

What transcription factors bind to this gene?

Where is the transcription factor binding site?

Bioinformatics Tony C Smith

a genetic prediction problem8
A genetic prediction problem

ttgcaatcggcgctacgcttcaaaatttattatattcccggc

Clues:

A binding site is often a short general pattern

E.g. CCGATNATCGG

Bioinformatics Tony C Smith

a genetic prediction problem9
A genetic prediction problem

ttgcaatcggcgctacgcttcaaaatttattatattcccggc

Clues:

The patterns are often reverse complements

E.g. CCGATNATCGG

GGCTANTAGCC

Bioinformatics Tony C Smith

a genetic prediction problem10
A genetic prediction problem

ttgcaatcggcgctacgcttcaaaatttattatattcccggc

Clues:

Where there is one binding site, often there is another nearby.

Bioinformatics Tony C Smith

a genetic prediction problem11
A genetic prediction problem

All of these properties are the kinds of things for which computer science has developed algorithms and data structures to identify quickly and efficiently, and therefore it is exactly the kind of problem computer scientists should be able to solve.

Bioinformatics Tony C Smith

proteomics
proteomics

Three consecutive nucleotides in the coding region

form a ‘codon’ … i.e. encode an amino acid.

A string of amino acids makes a protein.

3 nucleotides, 4 possibilities each:

43 = 64 possible codons

But there are only 20 amino acids!

Bioinformatics Tony C Smith

proteomics1
proteomics

There is quite a bit of redundancy in codons.

Glycine: GGA, GGC, GGG, GGT

Tyrosine: TAT, TAC

Methionine: ATG

Bioinformatics Tony C Smith

slide20

Amino Acid

R group

Amide

group

Carboxyl

group

Bioinformatics Tony C Smith

slide21

Amino Acid

tyrosine

glycine

Bioinformatics Tony C Smith

artificial intelligence
Artificial Intelligence
  • Computers do things only human brains can otherwise do

expert

expert

Bioinformatics Tony C Smith

artificial intelligence1
Artificial Intelligence
  • Computers do things only human brains can otherwise do

expert

system

expert

Bioinformatics Tony C Smith

artificial intelligence2
Artificial Intelligence
  • Computers do things only human brains can otherwise do

expert

system

learning

system

Bioinformatics Tony C Smith

machine learning
Machine learning
  • creating computer programs that get better with experience
  • learn how to make expert judgments
  • discover previously hidden, potentially useful information (data mining)

What is machine learning?

How does it work?

  • user provides learning system with examples of concept to be learned
  • induction algorithm infers a characteristic model of the examples
  • model is used to predict whether or not future novel instances are also examples – and it does this very consistently, and very, very quickly!

Bioinformatics Tony C Smith

biotechnology
Biotechnology
  • Biologists know proteins, computer scientists know machine learning
  • Together, they can find out a lot of hidden information about genes and proteins
  • Biotechnology is a multi-billion dollar industry
  • Biotechnology is one of the best funded areas of scientific research

Bioinformatics Tony C Smith

the university of waikato
The University of Waikato
  • Waikato University is the centre of the universe for machine learning
  • The Machine Learning Group is a large, globally active, well-funded research group
  • The WEKA workbench of ML tools is used around the world
  • Professors at Waikato University literally wrote the book on sequence modeling

Bioinformatics Tony C Smith

the university of waikato1
The University of Waikato

If you’re seriously interested in machine learning, in getting involved in bioinformatics research, or indeed any other area along the leading edge of computer science, then university is the only place to be, and

Waikato wants You!

Bioinformatics Tony C Smith