molly-roy
Uploaded by
1 SLIDES
142 VIEWS
10LIKES

Characterization of c-Fos and GAPDH Expression in Response to Genetic Modifications

DESCRIPTION

This study investigates the expression levels of c-Fos and GAPDH under various conditions influenced by specific genetic sequences. By utilizing techniques such as RT-PCR and Western blotting, we analyze the response of these genes to treatments, exploring their role in cellular processes and signaling pathways. Our findings contribute to a better understanding of gene regulation and protein expression dynamics, potentially revealing novel insights into cellular adaptations and functions in relation to various stimuli.

1 / 1

Download Presentation

Characterization of c-Fos and GAPDH Expression in Response to Genetic Modifications

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A) CTA TCT CCT GAA GAG GAA GAG AAA CGG AGA ATCCGA AGG GAA CGG AAT AAG ATG GCT GCA GCC AAGTGC CGG AAT CGG AGG AGG GAG CTG ACA GAT ACACTC CAA GCG gta ggt tga accagctgctgctcctgaa actttattaaagttggagcttgggactatgggcgcagggtcct tgagcatgcccgtgtctatgctttcttatatctctccctatgc ag GAG ACA GAT CAA CTT GAA GAT GAG AAG TCT B) kDa CE-0 CE-30 E-30 75 c-Fos 50 37 25 20 GAPDH

More Related