1 / 1

ERCC1

pGL3. pGDDB1L. Firefly Luciferase. ORF1. Firefly Luciferase. SV40 promoter. SV40 Poly (A). enhancer. AUG. SV40 promoter. enhancer. SV40 Poly (A). pGDDB1MtL. ORF1. Firefly Luciferase. AUA. enhancer. SV40 promoter. SV40 Poly (A). pGERCC5L/pGERCC1L. ORF1. ORF2.

miracle
Download Presentation

ERCC1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. pGL3 pGDDB1L Firefly Luciferase ORF1 Firefly Luciferase SV40 promoter SV40 Poly (A) enhancer AUG SV40 promoter enhancer SV40 Poly (A) pGDDB1MtL ORF1 Firefly Luciferase AUA enhancer SV40 promoter SV40 Poly (A) pGERCC5L/pGERCC1L ORF1 ORF2 Firefly Luciferase AUG SV40 promoter AUG SV40 Poly (A) pGERCC5Lmt/pGERCC1MtL ORF1 ORF2 Firefly Luciferase 0 0 0 3 3 3 6 6 6 AUA AUA SV40 promoter SV40 Poly (A) ERCC1 UUGAAUUCGGCGUGGCGUUACAGAGCCUCUAGCGCUGGGUGUUGGGGACCUGACGCU AUG GAG CUC UCG GAG UUU UGU GGG GGA CGG CUG UGA GUGGGGGGUUCCUGCUGCGGG AUG AGA ACG UAGACGCCAGUGGCUCACUCGCU CCUGGCA CCUUCCCUUUCAGGCUCCCCAUG ERCC5 GGAAACCGAGCGGGCCCAUUUUUC AUG GGU UUG CGG ACC CAC CAG CGA AGG CGG GAG GUG UCG CAG GGA CAU CUU CUG GCU GUU UCC GUC GCC UGC GUG GCC CUU GCA CCC CGG UCU UCC AUU AGC GGC GCA GAC GUU UGG GCC UAA GCGCUGGGCGAGGCGAGGCCCUGCCCCUCCCCGCCAACGGCCAUUCUCUGGACCUGUCUUUCU UCCGGGAGGCGGUGACAGCUGCUGAGACGUGUUGCAGCCAGAGUCUCUCCGCUUUA AUG CGC UCC CAU UAG UGCCGU CCCCCACUGGAAAACCGUGGCUUCUGUAUUAUUUGCCAUCUUUGUUGUGUAGGAGCAGGGAGGGCUUCCUCCCGGGGUCCUA GGCGGCGGUGCAGUCCGUCGUAGAAGAAUUAGAGUAGAAGUUGUCGGGGUCCGCUCUUAGGACGCAGCCGCCUCAUG DDB1 GCCUCCUUCGGUUGGCGGCCUCGGGCUUCGGGAGUCCUCCAAGAGGCCAGGUGAGGCCGUCCCGUG AUG CCC CGC GCC CCG GCC GCU CUG GCC UGC AAC GUG UCU CUG GGG CGG AGG CAG CGG CAG UGG AGU UCG CUG CGC GCU GUU GGG GGC CAC CUG UCU UUU CGC UUG UGU CCC UCU UUC UAG UGUCGCGCUCGAGUCCCGACGGGC CGCUCCAAGCCUCGACAUG A) 5’ UTRs of ERCC1, ERCC5 and DDB1 contain upstream open reading frames. The corresponding regions of DNA were obtained by RT-PCR and subcloned into the reporter vector constructs shown below. The uORFs are underlined B) Schematicdiagram of the constructs generated that contain the 5' UTRs of ERCC1, ERCC5 and DDB1. i) ii) Hrs 0 3 6 eIF2a(P) eIF2a 120 1 100 0.8 80 Relative luciferase activity Relative luciferase activity 0.6 60 0.4 40 0.2 20 0 0 Time (H) pGL3 pGL3 pRERCC5L pERCC5ML pGDDB1L pGERCC5L pGERCC1L pGERCC5L pGDDB1mtL pGERCC1mtL C i) The constructs shown in B were transfected into HeLa cells andand luciferase activity assayed. The data show that all three 5’ UTRs repress translation and in the case of DDB1 and ERCC1 mutation of the uORF AUGs relieves the repression. C ii The ERCC5 5’ UTR does not maintain translation following treatment of cells with thapsigargin ii)To test whether the 5’ UTR of ERCC5 was able to function when the alpha subunit of eIF2 was phosphorylated by a different mechanism, cells were transfected with the construct shown (B) and then treated with thapsigargin, harvested and assayed to determine any effects on luciferase activity. The data show that neither the wild type nor the mutant version of the constructs were resistant to the effects of this compound and the decrease in translation is similar to that observed with pGL3. Supplementary 4

More Related