1st quiz name date n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
1st Quiz, Name, date PowerPoint Presentation
Download Presentation
1st Quiz, Name, date

Loading in 2 Seconds...

play fullscreen
1 / 81

1st Quiz, Name, date - PowerPoint PPT Presentation


  • 99 Views
  • Uploaded on

1st Quiz, Name, date. 1 Pick one of the following two: A)What are some ecological roles played by native diseases? B)What are the elements of the disease triangle? 2 Pick one of the following two:

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about '1st Quiz, Name, date' - michel


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
1st quiz name date
1st Quiz, Name, date
  • 1 Pick one of the following two:
    • A)What are some ecological roles played by native diseases?
    • B)What are the elements of the disease triangle?
  • 2 Pick one of the following two:
    • A) In the Gilbert review, several categories of forest diseases are described: can you name and briefly describe three?
    • B)- Pick one category of forest diseases and write a paragraph about it
summary of 1 st class
Summary of 1st class
  • Emergent diseases different from native diseases
  • Disease triangle
  • DNA information useful to track microbes
roles of native diseases
“Roles of native diseases”:
  • Thin natural populations of trees
  • Optimal allocation of resources
  • Selection for a genetically diverse host population
  • Maintain tree ranges
  • Succession: nutrient cycling
emergent diseases diseases on the rise
“Emergent diseases”:diseases on the rise
  • New introduced, exotic, organisms
  • Good gone bad: e.g. climate change or human activities trigger excessive pathogenicity of native organism
disease triangle
DISEASE TRIANGLE

Pathogen

Host

Environment

emergent diseases 1 host
“Emergent diseases”:1: host
  • New host-pathogen combinations:

exotic hosts

hosts planted off site

cypress canker by seiridium cardinale
Cypress canker by Seiridium cardinale
  • Pathogen was first described in California in the 20s. Later it was described in Italy where it started a serous epidemic of Italian cypress
  • Belief that pathogen is native to California: is that true and why is it then causing a significant disease in our state?
use of molecular genetics to resolve issue of origin of pathogen
Use of molecular genetics to resolve issue of origin of pathogen
  • Used a technique similar to the one used in human forensics
  • Native populations should comprise many different individuals genetically
  • Introduced populations should be genetically simpler because of bottleneck related to introduction events
results ca vs europe
RESULTS: CA vs. Europe
  • California population diverse genetically= native to the state
  • European population show no diversity=introduced
slide11

Fig. 3

Symptoms caused by Seiridium cardinale on Cupressus macrocarpa (above) and xCupressocyparisleylandii (right)

slide12

Spread of the disease.

Seiridium cardinale, a pandemic in progress…

slide13

99.3

73.9

61.5

70.2

60.8

65.5

66.3

98.6

66.1

66.5

66.5

100

Seiridium NJ tree

IT=Italy

GR=Greece

NZ=New Zealand

US=USA

CH=Chile

slide14

5-B

2-B

3-A

11-B

21-B

8-A

19-B

9-na

6-B

4-B

15-A

16-B

1-B

17-A

18-B

13

20-A/B

14-A

46

12-A

30

37

26

39

35

32

33

41

43

38

28

23

7

45

25

24

44

34

29

31

36

40

42

27

22

10-na

30

Node scaling

Small: singleton MGs

Medium: 2-5 indivs with same MG

Large: 30 indivs with same MG

Dark blue = Italy only

Mid blue = Italy and other MED country

Light blue = Only MED country, excluding Italy

Black = Morocco

Red = California

A = clade A in NJ tree

B = clade B in NJ tree

na = no sequence available

Seiridium cardinale – Minimum spanning network

slide15

Results of coalescent analysis using MIGRATE-N

Populations

1 = Greece

2 = Italy

3 = Cal

Theta1 = 0.08826

Theta2 = 0.09727

Theta3 = 0.09735

M2-->1 = 347.450

M3-->1 = 6.392

M1-->2 = 23.160

M3-->2 = 6.886

M1-->3 = 5.142

M2-->3 = 6.180

why a disease in ca
Why a disease in CA?
  • If pathogen is native to California, why is it causing such a serious disease?
  • We observed that disease incidence is variable with:
    • cypress species,
    • location,
range of susceptibility
Range of susceptibility
  • Leyland cypress, Italian, monterey are listed as most susceptible
  • Arizona and McKnob are regarded as more resistant
range of susceptibility1
Range of susceptibility
  • 90% of Leyland are heavily infected
  • 10% of monterey
  • LEYLAND CYPRESS IS AN ORNAMENTAL CROSS, NOT NATIVE
range of susceptibility2
Range of susceptibility
  • Monterey is more susceptible in inland areas where it is NOT NATIVE: we believe that colder temperatures cause more wounds that lead to infection
conclusions
CONCLUSIONS
  • Cypress canker is a serious disease in Europe because pathogen was introduced
  • Cypress canker is a serious disease in California because hosts were introduced either through planting off range (Monterey cypress) or because host is artificial creation (Leyland cypress); extinction of LEYLAND is most likely
emergent diseases 2 environmental changes
“Emergent diseases”:2: environmental changes
  • Forestry and intensive forest use:

timber production

tree felling and creation of stumps

fire exclusion and increase in density

oversimplified forest composition

changes in forest composition

changes in forest structure

heterobasidion root disease
Heterobasidion root disease
  • Heterobasidion (a bracket or shelf mushroom) infects trees through wounds and stumps, then it spreads through the roots to neighboring trees
  • With tree felling,stumps and wounds are created, suddenly exponentially increasing infection levels
use of molecular genetics
Use of molecular genetics:
  • Differentiate Heterobasidion on fir/sequoias (H. occidentalis) from that on pine/junipers (H.irregularis)
  • Show that airborne meiospores are responsible for most infection of Heterobasidion
  • Show that in pines most infections start on stumps and that in true firs most infections on wounds
slide28

True firs

Pines

Each spore is a genetically different individual:

In pines we found the same genetic individual in stumps and

adjacent trees indicating direct contagion between the two

In true firs and true firs/sequoias we find same individual

in adjacent standing trees indicating infection not linked

to stumps but to wounds on standing trees

conclusions1
CONCLUSIONS:
  • Logging activities increase Heterobasidion infection because of stump creation in pines and because of wounding in true firs sequoias
  • We have shown that in pine stumps H. irregularis and H. occidentalis can both be present and create a new hybrid entity
  • We have shown that in the past these hybridization events have lead to sharing of genes among these two species (Horizontal gene transfers)
armillaria root diseases
Armillaria root diseases
  • Armillaria, the honey mushroom, normally infects the roots of trees. It can be a saprobe and a pathogen and is common amongst oaks
  • If woodland composition shifts to pine/oak, pines become the target of attacks and gaps in canopy enlarge over time. Stress (e.g. flooding) exacerbates susceptibility
how does it infect
How Does it Infect?
  • Two means of dispersal to other trees:
  • Mycelium can grow through direct root contacts and grafts with uninfected trees.
  • Rhizomorphs can grow through soil to contact uninfected trees.

OAK or PINE

DEAD OAK

SOURCE: http://www.forestpathology.org/dis_arm.html

what are rhizomorphs
What are Rhizomorphs?

SOURCE: http://www.nifg.org.uk/armillaria.htm

  • …“conglomerations of

differentiated parallel

hyphae with a protective

melanized black rind

on the outside.”

  • Rhizomorphs are able to transport food and nutrients long distances which allows the fungus to grow through nutrient poor areas located between large food sources such as stumps.

SOURCE: http://botit.botany.wisc.edu/toms_fungi/apr2002.html

humongous fungus
Humongous Fungus

It’s One of

U-HAUL’s “Bizarre Roadside Attractions”

http://botit.botany.wisc.edu/toms_fungi/apr2002.html

conclusions2

CONCLUSIONS

Human activities shifting from oak woodlands to mixed oak-pine lead to large mortality gaps in pines around oaks if honey mushroom is present

CHANGING SPECIES COMPOSITION LEADS TO SEVERE DISEASE

emergent diseases 3 exotic pathogens
“Emergent diseases”:3: exotic pathogens
  • 99% of times human responsible for their introduction
slide39

Like the conquistadores brought diseases that were lethal to those who had never been exposed to them, so do exotic diseases cause true devastation in plant communities because of lack of coevolution between hosts and microbes

california invaded 1849 a d
California invaded: 1849 A.D.

Port Orford Cedar Root Disease

1950s

New hybrid root pathogen

1990s

Manzanita/madrone die-back

Sudden Oak Death

1990s

White pine blister rust

1930s

Canker-stain of

Sycamores 1980’s

Dutch Elm Disease

1960s

Pitch canker disease

1980s

Oak root canker

2000

how can people transport pathogens
How can people transport pathogens
  • By transporting plants and plant parts
    • Crops, and seeds
    • Raw food
    • Ornamental plants

Untreated lumber

Soil

Insects vectoring fungi

Military activity

the irish potato famine
The Irish Potato Famine
  • From 1845 to 1850
  • Phytophthora infestans
  • Resulted in the death of 750,000
  • Emigration of over 2 million, mainly to the United States.
what favors invasion of exotic fungi
What favors invasion of exotic fungi ?
  • Density of host increases severity of disease
  • Corridors linking natural habitats
  • Synchronicity between host susceptibility and pathogen life cycle
  • Ecological and environmental conditions
slide46

Big Sur

2006

K. Frangioso

slide47

P. ramorum absent

P. ramorum present

Wickland et al., unpublished

organism new to science
Organism new to science
  • Origin unknown
  • Biology unknown
  • Symptoms caused unknown
  • Immediately though highly regulated
slide50

Rhododendron:

In EU mostly a nursery

issue, but also present in

nurseries in US and Canada

Stem canker

Leaf necrosis

is it exotic
Is it exotic?
  • Our studies have indicated that California population is extremely simplified, basically two strains reproducing clonally as expected of an introduced organism
  • Many hosts appear to have no resistance at all
  • Limited geographic distribution
where does it come from
Where does it come from?
  • It is unknown where pathogen originally comes from, but previous studies have shown that California forest population is derived from a relatively genetically diversified US nursery population, indicating ornamental nurseries were the most likely avenue for pathogen introduction
let s look at its genetic structure
Let’s look at its genetic structure
  • Need a number of independent and neutral DNA markers
  • Used AFLP, a technique that scans the entire nuclear genome
  • Are our isolates the same as the European ones?
  • Is the genetic structure suggestive of an introduced or native species?
slide55

US forest isolates clearly distinct from EU nursery isolates, also have different mating type

  • Isolates from nurseries in WA, OR, & BC both of the US and EU types
  • Potential for XXX sex and recombination in US nurseries
  • US forest population is genetically very homogeneous, trademark of an introduced species
the entire genome was sequenced in less than 3 years since discovery of organism
The entire genome was sequenced in less than 3 years since discovery of organism

* 12 SSR loci (di- and tri- repeats identified)

* Loci selected to be polymorphic both between and within continental populations

* 500+ representative isolates analyzed

CCGAAATCGGACCTTGAGTGCGGAGAGAGAGAGAGACTGTACGAGCCCGAGTCTCGCAT

slide57

Mating

Type

A1

A2

A2

Growth

Rate

Fast

Slow

Fast

slide58

Terminology

Genotype Lineage Population

results of 1st microsatellite study
Results of 1st microsatellite study
  • There actually three distinct (genotypically and phenotypically) lineages of P. ramorum
  • Very low diversity in US forests (microsats cannot discriminate among individuals, clonality confirmed), only one lineage
  • Several genotypes but only one lineage in EU nurseries
  • Three lineages in US nurseries
where was it introduced

Positive isolation

P. ramorum

Where was it introduced?
  • First reports mid 90’s
  • Pathogen identified in 2000
  • By then, the pathogen was widespread
  • CLUES: severity of symptoms and anedoctal stories
slide64

nurseries

Introduction phase

1- Escape of pathogen from

Infected nursery plants at two

locations: Mount Tamalpais

(Marin County), and Scott’s

Valley (Santa Cruz County)

2- Nurseries and two sites

have identical strain

composition, but distance

between sites is impossible

for natural spread of

organism

what favors invasion of exotic fungi1
What favors invasion of exotic fungi ?
  • Density of host increases severity of disease
  • Corridors linking natural habitats
  • Synchronicity between host susceptibility and pathogen life cycle
  • Ecological and environmental conditions
bay oak association
Bay/Oak association

Bay

Coast Live Oak (no sporulation)

Canker margin in phloem

Bleeding canker

Sporangia

synchrony pathogen host
Synchrony pathogen-host

Susceptibility of oaks

(lesion size)

slide70

Wetness > 12 h

Temp >19 C

how to control emergent exotic diseases
How to control emergent exotic diseases
  • PREVENT THEIR INTRODUCTION
  • LIMIT THE HUMAN-SPREAD OF PATHOGENS (infected plants, plant parts, dirty tools)
  • EMPLOY HOST RESISTANCE
  • CHEMICAL AND OTHER MITIGATION STRATEGIES
prevent diagnose
PREVENT: Diagnose

Symptoms relatively generic, very

variable, and pathogen not always

culturable

LAB CULTURES

DNA TESTS

slide78

Agrifos vs. Azomite Treatments

(efficacy 1 - 24 months)

a

a

Canker Size (mm)

b

why emphasis on molecular analyses
Why emphasis on molecular analyses?
  • As a way to identify and quantify microbes in the environment
  • As a way to understand microbial biology: how do microbes reproduce and infect hosts
  • As a way to determine epidemiology: follow the movement of a strain
why emphasis on molecular analyses1
Why emphasis on molecular analyses?
  • As a way to determine potential for spread: use genes as markers for individuals
  • As a way to determine whether population of microbes is exotic or native
  • As a way to identify source of a pathogen and migration patterns
why emphasis on molecular analyses2
Why emphasis on molecular analyses?
  • As a way to determine the size of the gene pool of a pathogen, Important to scale management options
  • As a way to determine rapid evolutionary changes linked to an introduction
  • As a way to determine epigenetic effects