dna variation in ecology and evolution i organization of the genome l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
DNA variation in Ecology and Evolution I- Organization of the genome PowerPoint Presentation
Download Presentation
DNA variation in Ecology and Evolution I- Organization of the genome

Loading in 2 Seconds...

play fullscreen
1 / 34

DNA variation in Ecology and Evolution I- Organization of the genome - PowerPoint PPT Presentation


  • 191 Views
  • Uploaded on

DNA variation in Ecology and Evolution I- Organization of the genome. Maria Eugenia D’Amato. BCB 703: Scientific Methodology. Aim of the course. Understanding the underlying principles and forces that mold genetic variation in organisms. DNA. Organization of the genetic information.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'DNA variation in Ecology and Evolution I- Organization of the genome' - matia


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
dna variation in ecology and evolution i organization of the genome

DNA variation in Ecology and EvolutionI- Organization of the genome

Maria Eugenia D’Amato

BCB 703:

Scientific Methodology

aim of the course
Aim of the course

Understanding the underlying principles and forces that

mold genetic variation in organisms

  • DNA. Organization of the genetic information.
  • Methodological approaches to the study of genetic variation. Application of molecular markers.
  • Patterns of genetic variation and inference of underlying processes in natural populations
domestication an early understanding of transmission of characters
Domestication: an early understanding of transmission of characters.

Early Neolithic

wild

Bronze Age

Present day

Ovis orientalis

Maize

discovery of the mechanisms of inheritance
Discovery of the mechanisms of inheritance

Cross-pollination

experiments with peas

Gregor Mendel (1822- 1884)

mendelian laws of inheritance
Mendelian laws of inheritance

Parental genotype

GgWw

Parental genotype

GgWw

  • Independent assortment
  • Independent segregation
  • Dominant-recessive
meiosis
Meiosis

4c

2c

2c

2c

c

Homologous chromosomes

segregate

2 haploid cells with

duplicated genetic material

Sister chromatides

segregate

4 haploid cells

mitosis
Mitosis

2N - Homologous chromosomes

2C

Homologous chromosomes

duplicate information

4C

Sister chromatides separate

2N chromosomes

2C

nuclear genetic information
Nuclear genetic information

Condensation of chromatin

Human karyotype

molecular structure of dna
Molecular structure of DNA

5’

Purines

3’

Pyrimidines

H-bond

3’

5’

discovery of dna molecular structure
Discovery of DNA molecular structure

James Watson Francis Crick

(1928- ) 1916-2004

Nobel Price 1962

Rosalind Franklin

1920-1958

Maurice Wilkins

1916-2004

Nobel Price 1962

nuclear dna coding and non coding sequences
Nuclear DNA: coding and non-coding sequences
  • Coding DNA Genes.
  • Ribosomal and transfer RNA.

Satellite DNA

Introns

Microsatellites

Transposon-like elements

  • Non-coding DNA

Regulatory regions

Interspersed repetitive DNA

genes the coding dna
Genes: the coding DNA

The role of the three types of gene products: mRNA, tRNA, rRNA

tRNA

Yeast 18S and 5.8 S rRNA

genes organization of rrna and trna
Genes: organization of rRNA and tRNA

tRNA and rRNA genes are organized in clusters of repeats

rDNA repeat unit

Ribosomal genes

Nucleolus-organizing region in wheat

gene families concepts
Gene families: concepts

Orthologs

Homologs

Paralogs

Identity by descent

different function

time

Identity by descent

Similar function

Identity by descent

non coding dna 1 satellite dna
Non-coding DNA1. Satellite DNA

ATTCATTCGATATAAAAAAACGTATATTA….

  • Repeats = 100s -1000s
  • base pairs
  • centromeric- telomeric position
non coding dna 2 minisatellites and the origin of dna fingerprinting
Non-coding DNA2.Minisatellites and the origin of DNA fingerprinting

Locus 1

(GATTTAA)9

(GATTTAA)7

  • VNTR, 10-100 bp repeats
  • Mostly subtelomeric position
  • Individual identification

Sir Alec Jeffreys

non coding dna 3 microsatellites
Non-coding DNA3. Microsatellites
  • (AC)n, (ACT)n, (AGTA)n, etc
  • STR, simple sequence repeats stretches of 2-6 bp
  • Allelic number is high, mutation rate high.
  • Accurate individual identification.
  • Use in genome mapping, forensics, population studies,
  • pedigree reconstruction, etc.
mobile elements the origin of interspersed repetitive dna
Mobile elements.The origin ofinterspersed repetitive DNA
  • Fragments of DNA that self-propagate within cell genome
  • Cause mutations
  • Challenge the central dogma
  • of molecular biology

Barbara McClintock, 1902-1992.

Nobel Price 1983

mobile elements retrotransposons
Mobile elements: Retrotransposons

LTRs

  • RNA is copied into DNA and inserted elsewhere in the genome
  • 40% of human genome is composed of retroelements
  • Propagation similar to retroviral infections (HIV, HTLV, etc)
  • LINES
  • SINES (Alu elements)

RNA

cDNA

Target DNA

insertion

the other genome mitochondrial dna
The other genome:mitochondrial DNA
  • Coding for 13 proteins, 22 tRNA, 2rRNA
  • Maternally inherited
  • Higher evolutionary rate than nuclear DNA
  • Utilized in the study of
  • microevolutionary processes, phylogenetics,
  • phylogeography, etc
the genetic code
The genetic code
  • Information coding for aminoacids is carried by codons in DNA and recognized by the anticodons in the tRNA
  • The genetic code is redundant
  • Different code for mtDNA, nuclear DNA, clDNA and taxonomic levels.
genetic code examples
Genetic code: examples

Hystidine.

Transversion in 3rd position changes to Glutamine

2-fold degeneracy

Alanine

4-fold degeneracy

Serine is coded by

6 different codons

Krill COI

Glycine changes to Cysteine

Change in 1st position

0-fold degeneracy

Q

the origin of genetic variation mutations
Change in the heritable material

Raw material of evolution

Source of variation to be affected by evolutionary processes

The origin of genetic variation: MUTATIONS

Point mutations

Gene duplication

Chromosomal rearrangements

Polyploidization

Types

types of mutations
Types of mutations
  • Single point
  • Insertions
  • Deletions

Synonymous

Protein coding genes

Non-synonymous

Intronic regions

Number of repeats in

microsatellites

Within loci

Changes in RNA genes

point mutations
Point mutations

Transversions

A

T

Purine- Purine

Transitions

C

G

Pyrimidine- Pyrimidine

insertions and deletions
Insertions and deletions
  • Reading frame changes in protein-coding regions.

Asn Arg Leu Ser Arg

AAT CGA TTA TCT AGG

AAT ACG ATT ATC TAG G..

Single point insertion

Asn Thr Ile Ile STOP

New reading frame

insertions and deletions30
Insertions and deletions

Krill ITS-1

CCCCCATCA

CCCCC-TCA

chromosomal rearrangements
Chromosomal rearrangements

+

A

B

C

D

E

F

A

B

E

D

C

F

A

B

C

D

E

F

A

B

C

D

G

H

I

D

G

H

I

J

K

J

K

E

F

Inversion

Fusion

Translocation

changes at the ploidy level
Ploidy: number of single sets of chromosomes in a cell or organismChanges at the ploidy level
  • Polyploidy is a common speciation processes in plants
    • Tetraploids: maize, cotton, leek
    • Hexaploids: wheat, oat.
    • Octaploids: strawberries, sugar cane.
how often do mutations occur
How often do mutations occur?

Mutation rate :

the number of mutation events per gene per unit of time

Mutation rates per generation

Per base pair ~10-8 - 10-9

nuclear coding Per gene ~10-6 - 10-5

Per genome ~0.02 - 1

Microsatellites per loci 10-3 - 10-4

HVR human mtDNA 4.3 10-3

molecular clocks
Molecular clocks

A

C

B

  • Constant mutation rate
  • Inference of divergence time

time