slide1 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Genetics… …in the News PowerPoint Presentation
Download Presentation
Genetics… …in the News

Loading in 2 Seconds...

play fullscreen
1 / 123

Genetics… …in the News - PowerPoint PPT Presentation


  • 153 Views
  • Uploaded on

Genetics… …in the News. Chromosomal Mutations. Chromosome mutations are variations from the wild-type condition in... chromosome number, chromosome structure,. Karyotypes (viewing chromosomes). …the chromosome complement of a cell or individual,

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Genetics… …in the News' - marlee


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Genetics…

…in the News

chromosomal mutations
Chromosomal Mutations
  • Chromosome mutations are variations from the wild-type condition in...
    • chromosome number,
    • chromosome structure,
slide3

Karyotypes(viewing chromosomes)

…the chromosome complement of a cell or individual,

.. refers to the arrangement of metaphase chromosomes according to length,

physical maps cytological maps

p

1

2

3

q

Physical Maps(Cytological Maps)
  • AT versus GC rich regions stain differently,
    • i.e. Giesma stain,
    • in a very reproducible fashion.
  • Short arm “petit” (p), long arm (q),
  • #s refer to regions, with differential staining.
chromosomal mutations8
Chromosomal Mutations
  • chromosome number,
  • structure,
aneuploidy
Aneuploidy

...the gain or loss of a single chromosome,

  • monosomy: the loss of a single chromosome,
  • trisomy: the gain of a single chromosome.
meiotic nondisjunction
Meiotic Nondisjunction

...variation in chromosome number is caused by the failure of paired homologs to segregate properly during meiosis.

slide11

2n = 46, if human

We are following one pair of homologs.

haploid gamete

Disomic

Normal Disjunction

first division

second division

(gametes)

slide12

2n = 46, if human

We are following one pair of homologs.

haploid gamete

Trisomic

Trisomic

Monosomic

Monosomic

Nondisjunction

First Division

first division

second division

(gametes)

slide13

2n = 46, if human

We are following one pair of homologs.

haploid gamete

Disomic

Disomic

Trisomic

Monosomic

Nondisjunction

Second Division

first division

second division

(gametes)

monosomy 2n 1

45, -5

Monosomy, 2n - 1

2n =

46

The loss of a single chromosome in an otherwise diploid cell.

autosomal monosomy

C

c

a

A

B

B

C

c

Aa BB Cc Dd EE

C

CC

Cc

D

d

c

Cc

cc

recessive lethal allele

E

E

recessive lethal alleles

monosomic

Autosomal Monosomy
  • nearly always deleterious, usually lethal,
    • recessive lethal alleles are expressed,

diploid

trisomy 2n 1
Trisomy, 2n + 1

2n =

46

47,+3

The gain of a single chromosome in an otherwise diploid cell.

autosomal trisomy

A

a

a

B

B

B

C

c

c

D

d

d

E

E

E

Autosomal Trisomy
  • generally deleterious,
    • usually changes the phenotype of the individual,

trisomic

down syndrome 2n 47 2121
Down Syndrome (2n = 47, +21)
  • occurs at a frequency of about 0.15%,
  • mental retardation (I.Q. 20 - 50),
  • mean life expectancy is about 17 years,
  • 47, +21 females are fertile,
  • trisomy 21 risk factors, maternal age.
down syndrome
Down Syndrome

Trisomy in Humans

down syndrome critical genes
Down Syndrome Critical Genes
  • Chromosome 21 has about + 351 genes,
    • natural feedback mechanisms limit dosage effects of most of these genes,
  • It is estimated that the improper expression of approximately 20-40 genes produces the variety of phenotypes.
maternal age
Maternal Age?
  • in female humans*, oocytes arrest in Prophase I before birth,
    • meiosis continues upon menstruation,
    • thus, tetrad formation and cellular function must be maintained for decades.
  • and, as mother’s age increases, maternal detection of trisomy may be attenuated and spontaneous abortions drops.

* Research may suggest otherwise.

other human autosomal trisomics
Other Human Autosomal Trisomics
  • Edwards Syndrome (2n = 47, +18)
    • 0.0125% live births,
    • mental abnormalities,
    • “faunlike ears”, “rockerbottom feet”, small jaw,
    • nearly all die within several weeks of birth,
  • Patau Syndrome (2n = 47, +13),
    • 0.005% live births,
    • mental abnormalities,
    • cleft lip, small mal-formed head, “rockerbottom feet”,
    • mean life expectancy is about 130 days.
autosomal trisomy causation
Autosomal Trisomy Causation
  • Age of Parents,
  • Random Errors,
    • or genetic predisposition,
  • Especially malfunction of recombination machinery,
    • crossing over and subsequent recombination are necessary for proper chromosome disjunction.
sex chromosome monosomy
Sex Chromosome Monosomy
  • Turner Syndrome (2n = 45, X),
    • sometimes referred to as XO,
turner syndrome 2n 45 x
Turner Syndrome(2n = 45, X)
  • - 0.03% live female births,
  • - infertile,
  • - normal intelligence,
  • although specific
  • cognitive functions
  • may be affected.
sex chromosome trisomy
Sex Chromosome Trisomy
  • Klinefelter Syndrome (2n = 47, XXY),
klinefelter syndrome 2n 47 xxy
Klinefelter Syndrome (2n = 47, XXY)
  • - 0.1% - 0.2% live male births,
  • - infertile,
  • - mildly retarded.

48, XXXY; 48, XXYY;

49, XXXXY; 49, XXXYY

xxx syndrome 2n 47 xxx
XXX Syndrome(2n = 47, XXX)
  • 47, XXX Syndrome,
    • 0.08 % female births,
    • typically normal development,
    • fertile.
xyy syndrome 2n 47 xyy
XYY Syndrome(2n = 47, XYY)
  • 2n = 47, XYY Syndrome,
    • 0.10 % male births,
    • above average height,
    • sub-normal intelligence,
    • fertile.

Genetic Disposition for Antisocial and Criminal Behavior?

No.

slide34

850,000 Live Births

150,000 Spontaneous Abortions

5165

Chromosomal Abnormalities

1849 (about 2:1 males)

Sex Chromosome Aneuploid

1183 (20: 2: 1)

Autosomal Trisomics

1,000,000 Conceptions

slide35

850,000 Live Births

150,000 Spontaneous Abortions

75,000

Chromosome Mutations

39,000; Trisomics

13,500; XO

1,000,000 Conceptions

aneuploidy summary
Aneuploidy Summary
  • Autosomal Monosomy,
    • nearly always deleterious,
  • Autosomal Trisomy,
    • usually deleterious,
    • trisomic individuals usually show distinct phenotypes,
  • Sex Chromosome Aneuploidy,
    • results in Turner or Klinefelter Syndromes,
    • 2n = 47, XXX, often normal,
    • 2n = 47, XYY, mild retardation, tall.
chapter 5
Chapter 5
  • Do all of the practice questions (except 20).
chromosomal mutations39
Chromosomal Mutations
  • Chromosome mutations are variations from the wild-type condition in...
    • chromosome number,
    • chromosome structure,
polyploidy
Polyploidy

…more than two haploid sets of chromosomes are present,

  • 2n = diploid,
  • 3n = triploid,
  • 4n = tetraploid,
  • etc.
polyploidy generalities de novo
Polyploidy Generalitiesde novo
  • rare in most animal species,
  • known in lizards, fish and amphibians,
  • fairly common in plants,
  • odd numbers of ploidy are not usually maintained,
    • 3n, 5n, etc.
      • rarely found in organisms that rely on sexual propagation.
autopolyploidy
Autopolyploidy

...polyploidy resulting from the replication of one or more sets of chromosomes,

…the additional set of chromosomes is identical to the normal haploid complement of that species.

slide43

added

2x

1x

autopolyploidy44
Autopolyploidy

…can be induced by treating cells with the drug colchicine,

  • colchicine: is a alkaloid derivative from the autumn crocus (Crocus veneris),

...inhibits microtubule polymerization, and thus inhibits the separation of chromosomes during meiosis.

Crocus veneris

…autumn crocus,

…meadow saffron,

…naked ladies.

colchicine treatment
Colchicine Treatment
  • 2n cells undergo S-phase,
  • no separation of chromosomes is accomplished,
  • no cell division occurs,
  • at telophase, the nuclear membrane reforms,
  • treatment for one cell cycle leads to 4n cells.
natural autopolyploidy
Natural Autopolyploidy
  • Heat, cold also affect microtubule polymerization and can lead to autopolyploidy.
allopolyploidy
Allopolyploidy

…formed by the union of two or more distinct chromosome sets,

...i.e., from different species.

the sad tail of raphanobrassica vegetable of the proletariet
The Sad Tail of Raphanobrassica…Vegetable of the Proletariet?

Cast

Dr. G. Karpechenko, Russian Plant breeder,

Brassica oleracea(2n = 18),

- cabbage, large above ground food stock, ~value-less root,

Raphanus sativus (2n = 18),

- the common radish, large root food stock, ~value-less leaves.

super vegetable

n1 + n2 = 18

spontaneous autopolyploidy

Super Vegetable?

x

Cabbage Radish

2n1 = 18 2n2 = 18

n1 = 9 n2 = 9

sterile

2n1 + 2n2 = 36

amphidiploid
Amphidiploid

…double diploid,

2n1 + 2n2

…have balanced gametes of the type n1 + n2,

these gametes fuse to make fertile 2n1 + 2n2.

raphanobrassica
Raphanobrassica?
  • Roots of cabbage, leaves of radish,
    • dud-vegetable for Karpechenko, abandoned the project.
  • Revived by the Scottish Plant Breeding Station in Dundee, Scotland,
    • Raphanobrassica’s high dry matter content makes it an excellent fodder for sheep and cattle.
allopolyploidy in plants
Allopolyploidy in Plants

Wheat

Cotton

Apples

Plums

Strawberries

Longanberries

Tobacco

Potatoes

more...

autopolyploidy applications
Autopolyploidy Applications

Plant secondary metabolite, inhibits microtubule function

  • Treating a parent plant with colchicine often produces autopolyploidy, resulting in offsprings with larger flowers and/or fruit,

4n

2n

8n

2n

allopolyploidy applications

n = 9

B. napas ( Oil rape, canola oil)

2n1 + 2n2 = 38

n = 10

amphidiploid

Allopolyploidy Applications

B. oleracea(cabbage, cauliflower, Brocolli, kale, etc.)

2n = 18

n1 + n2 = 19

B. campestris(turnip, turnip rape)

2n = 20

4n x 2n 3n
4n x 2n = 3n?
  • The creation of triploids can be accomplished by crossing a tetraploid with a diploid,
  • Most triploid individuals are sterile.
who d want to eat that
Who’d want to Eat That?
  • Bananas,
  • Seedless Watermelon,
  • Most other seedless varieties,
  • Some oysters.
environmental applications
Environmental Applications?

grass carp

(Ctenopharyngodon idella)

  • grass carp prefer pondweeds,
  • do not prefer plants such as cattail, water lily, etc.
  • Triploid grass carp do not reproduce…
polyploidy summary
Polyploidy Summary
  • More than 2 whole sets of chromosomes,
  • Autopolyploidy,
    • from the same genome,
    • naturally occurring, or induced,
    • often results in larger varieties,
  • Allopolyploidy,
    • from different genomes,
    • naturally occurring, or induced,
    • often results in larger varieties,
  • Autotriploids,
    • most often sterile
    • can produce beneficial traits.
monoploidy
Monoploidy

…a haploid of a diploid is monoploid,

…has one chromosome set.

monoploid
Monoploid
  • male wasps, bees and ants have only 1 haploid genome,
    • males develop from unfertilized eggs,
      • gametes are formed by mitosis.

Bees (example)

monoploid applications
Monoploid Applications
  • monoploid plants can be created by culturing pollen grains (n = 1),
    • the population of haploid organisms is then screened for favorable traits,
    • the plants are then treated with colchicine which generates a 2n plant homozygous for the favorable trait(s).
chromosomal mutations66
Chromosomal Mutations
  • chromosome number,
  • structure,
chromosome structure
Chromosome Structure
  • Changes in chromosome structure can come about due to,

deletions

duplications

rearrangements

chromosomal deletions
Chromosomal Deletions
  • …a deletion results in a lost portion of a chromosome,
    • deletion causative agents,
      • heat,
      • radiation,
      • viruses,
      • chemicals,
      • errors in recombination.
intercalary deletions
Intercalary Deletions

From the Middle

homologous pairs

Intercalary

Terminal

Homologous Pairs?

Hemizygous

Hemizygous: gene is present in a single dose.

Psuedodominance: hemizygous genes are expressed.

deletions
Deletions

…result in partial monosomy,

  • remember monosomy: 2n, -1,

…the organism is monosomic for the portion of the chromosome that is deleted,

…as in monosomy, most segmental deletions are deleterious.

2n 46 5p
2n = 46, -5p

...terminal deletion of the small arm (petite arm) of chromosome 5,

  • Cri-du-chat Syndrome,
    • 0.002% live births,
    • anatomic mutations,
    • often mental retardation,
    • abnormal formation of vocal mechanisms.
chromosome structure76
Chromosome Structure
  • Changes in chromosome structure can come about due to,

deletions

duplications

rearrangements

chromosomal duplication
Chromosomal Duplication

...an event that results in the increase in the number of copies of a particular chromosomal region,

duplication cause and effect
Duplication Cause and Effect

Causes:

  • duplications often result from unequal crossing over,
  • can occur via errors in replication during S-Phase.

Effects:

  • results in gene redundancy,
  • produces phenotypic variation,
  • may provide an important source for genetic variability during evolution.
unequal crossing over
Unequal Crossing Over

Produces both duplications and deletions!

duplication in evolution
Duplication in Evolution

…essential genes do not tolerate mutation,

…duplications of essential genes, followed by mutations, confers adaptive potential to the organism,

…new gene family members are ‘recruited’ to perform new functions.

slide81

flowering plant

moss

need uptake

need uptake

transport to other tissue

transport to other tissue

transport to seeds

algae

nutrients

need uptake

chromosome structure83
Chromosome Structure
  • Changes in chromosome structure can come about due to,

deletions

duplications

rearrangements

chromosomal inversions
Chromosomal Inversions

…inversion: aberration in which a portion of the chromosome is turned around 180o.

paracentric inversion

A

B

C

B

A

Paracentric Inversion

...an inversion in which the centomere is not included,

A

B

C

...a paracentric inversion does not change arm length ratio.

inversion heterozygotes

A

B

C

B

A

C

Inversion Heterozygotes

…an organism with one wild-type and one chromosome containing an inversion,

…not heterozygous for the genes, heterozygous for the chromosomes.

slide88

Paracentric

Produces haploid gamete.

slide89

Paracentric

Produces gamete with inversion.

slide90

Paracentric

Produces a chromosome with two centromeres.

Nonviable gametes.

dicentric
Dicentric

...a chromosome having two centromeres;

slide93

Dicentric/Ascentric

…results only when the crossing over occurs within the region of the paracentric inversion,

slide94

Paracentric

No centromeres. Deletions.

Nonviable gametes.

acentric
Acentric

…a chromosome having no centromeres,

…segregates to daughter cells randomly, or is lost during cell division,

…deletions impart partial monosomy.

paracentric outcomes
Paracentric Outcomes

1 Normal Gamete, 1 Inversion Gamete, No Crossover Classes

Recombination is not inhibited, but recombinant gametes are selected against.

pericentric inversion

A

B

C

A

C

B

Pericentric Inversion

...an inversion in which the centromere is included,

...a pericentric inversion results in a change in chromosome arm length.

recombination and inversions
Recombination and Inversions
  • Paracentric and Pericentric;
    • 1 Normal Gamete,
    • 1 Inverted Gamete,
    • (No) Crossover Classes = No Recombination… …in area of inversion.

Inversions select against recombinant gametes, thus preserves co-segregation of specific alleles.

inversions and evolution
Inversions and Evolution
  • Inversions ‘lock’ specific alleles together,
    • all offspring get their alleles from either a wild-type, or inverted chromosome,
  • If the ‘set of alleles’ is advantageous, the set can be maintained in the population.
assignment
Assignment
  • Know how inversions alter the outcomes of recombination,
  • Understand the differences between ‘Interference’, and the suppression of recombination resulting from inversions,
  • Be able to recognize data, and predict results given either case.
chapter 5102
Chapter 5
  • Do all of the practice questions (except 20).
chromosome structure103
Chromosome Structure
  • Changes in chromosome structure can come about due to,

deletions

duplications

rearrangements

translocations
Translocations

…translocation: aberration associated with the transfer of a chromosomal segment to a new location in the genome.

translocation and semi sterility
Translocation and Semi-Sterility

…semi-sterility; a condition in which a proportion of all gametophytes (in plants) or zygotes (in animals) are inviable.

  • Up to 50% are not viable as a result of translocations.
robertsonian translocations
Robertsonian Translocations

…the fusion of long arms of acrocentric chromosomes,

down syndrome110
Down Syndrome
  • 95% of Down Syndrome individuals are a result of Trisomy 21,
    • the probability of having a second Down Syndrome child is usually similar to the population at large,
  • However, there is second cause of Down Syndrome caused by a Robertsonian translocations that is heritable.
assignment112
Assignment
  • Do a Punnett Square or a Split ForkDiagram of,

Parent 1: wild-type for Chromosomes 14, 21

x

Parent 2: heterozygous for 14q;21q translocation.

slide113
Hint

gametes

trinucleotide repeat expansions

...GCGCGGCGGTGACGGAGGCGCCGCTGCCAGGGGGCGTGCGGCAGCG...

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

…CTGGGCCTCGAAGCGCCCGCAGCCA

Trinucleotide Repeat Expansions

FMR1

Fragile X Mental Retardation 1

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

cgg

> 200

...

syntenic
Syntenic
  • Relationship of two or more loci found to be linked in one species; literally “on the same thread”.
  • Conserved Synteny: state in which the same two loci are found to be linked in several species.
conserved synteny
Conserved Synteny

Description of DNA segments in which gene order is identical between species.

chapter 5 review
Chapter 5 Review
  • know genotypes and phenotypes for exam 2,
    • trisomy,
    • monosomy,
    • inversions,
    • duplications,
    • deletions,
    • polyploidy,
    • dosage compensation.
  • be able to predict heritability, and recognize data-sets and infer the condition.
wednesday
Wednesday
  • Work Chapter 5 problems, we’ll work them together.
  • Quiz through assigned reading (syllabus).
  • Keep studying.
exam 1
Exam #1

Mean = 82.5%

Median = 81%

Mode = 82.5%

A range: | | | | | | | | | | | |

B range: | | | | | | | | | | | |

C range: | | | | | |

D range: | | | | | |

Failing: |