160 likes | 279 Views
A Three-Single-Nucleotide Polymorphism Haplotype in Intron 1 of OCA2 Explains Most Human Eye- color Variation. D L Duffy, G W Montgomery … and R A S turm. American Journal of Human Genetics 80 , 241-251 (2007). Heredity of Eye- Color in Man . Gertrude C. Davenport and Charles B. Davenport.
E N D
A Three-Single-Nucleotide Polymorphism Haplotype in Intron 1 of OCA2 Explains Most Human Eye-color Variation D L Duffy, G W Montgomery … and R A Sturm American Journal of Human Genetics 80, 241-251 (2007)
Heredity of Eye-Color in Man Gertrude C. Davenport and Charles B. Davenport Science 26(679) 589-592 (1907) No institution - and no references Very small sample sizes People had bigger families Simplified model - blue and brown eye colors
Two genes for eye colour. Can be either brown (B) or blue (b) Brown is dominant; blue is recessive BB has brown eyes; bb has blue eyes; Bb has brown eyes. One gene inherited from each parent. Consequently, two blue eyed parents can only have blue eyed children
R A Sturm and T N Frudakis, Trends in Genetics 20, 327 (2004)
The Eye Color calculator (http://www.thetech.org/genetics/eyeCalc/eyecalculator.html)
Green gene can be either green (G) or blue (b). Each with probability 0.5 (?) Brown gene can be either brown (B) or blue (b) Brown dominates both green and blue. Green dominates blue. Two green eyed parents could both be Gb So child could be bb = blue eyed (or GG or Gb both green eyed) BUT green eyed parents couldn’t have a brown eyed child
DNA sequences 4 nucleotides (or bases) Adenine a Guanine g Cytosine c Thymine t a pairs with t c pairs with g gattcaggaccctatcag… ctaagtcctgggatagtc…
Amino Acids tctgccgcaagataa SerAlaAlaArg STOP Triples of nucleotides code for Amino acids e.g. glycine, alanine, arginine, valine. Several hundred amino acids chain together to make up a protein Coding regions (exons) are not contiguous Separated by intervening regions (introns)
Single nucleotide polymorphisms gattcaggaccctatcagaaaggtatca gattcaggaccctatcggaaaggtatca Unrelated individuals have DNA sequences that differ by about 0.1% SNP is a difference of one letter in the sequence Coding region SNP’s can be synonymous or nonsynonymous
Bioinformatics Analysis of DNA sequences using just IT Possible to move away from lab based biology! Human genome has 3 X 10**9 base pairs
A Three-Single-Nucleotide Polymorphism Haplotype in Intron 1 of OCA2 Explains Most Human Eye-color Variation OCA2 – Oculocutaneous albinism type 2 Gene responsible encodes the P protein
Study population of 5075 Excluding identical twins gave 3011 people Detailed analysis of 40 individuals Analysed 75 SNP’s in OCA2 using PCR PCR = Polymerase Chain Reaction Really a machine for gene sequencing
3 SNPs in intron 1 1. rs7495174 t ↔ c 2. rs6497268 g ↔ t 3. rs11855019 t ↔ c tgt + tgt found in 62.2% of samples 62.5% had blue eyes 28% had green eyes 9.5% had brown eyes
tgt + tcc found in 5% of samples 47.1% had blue eyes 20.3% had green eyes 32.6% had brown eyes 74% of eye-colour variation can be attributed to the OCA2 region
Conclusions Eye colour is polyfactorial Two blue eyed parents can have a brown eyed child, although it is rare Results consistent with other work Sense that this is a work in transition