430 likes | 708 Views
Protein functions prediction. Signal peptides Transmembrane regions and topology PTM (post-translational modifications) Low complexity and biased regions Repeats Coils. Secondary structure Antigenic peptides Domain/Motifs Tools The EMBOSS package. Introduction . Different techniques.
E N D
Signal peptides Transmembrane regions and topology PTM (post-translational modifications) Low complexity and biased regions Repeats Coils Secondary structure Antigenic peptides Domain/Motifs Tools The EMBOSS package Introduction
Different techniques • Algorithms • Sliding window, Nearest Neighbor • Patterns, regular expression • Weight matrices • HMM, profiles • Neural Networks • Rules
Sliding window THISISATESTSEQVENCETHATDISPLAYSTHESLIDINGWINDQW Score1 Scoren Score2 Width or Size=11, Step=5 Results are usually displayed as a graph, see example ->
Patterns / regular expression • Pattern: <A-x-[ST](2)-x(0,1)-{V} • Regexp: ^A.[ST]{2}.?[^V] • Text: The sequence must start with an alanine, followed by any amino acid, followed by a serine or a threonine, two times, followed by any amino acid or nothing, followed by any amino acid except a valine. • Simply the syntax differ…
Neural Networks General principle: Example:
N-ter exportation - secretion mitochondria chloroplast internal NLS (nuclear localization signal) C-ter GPI-anchor (Glycosyl Phosphatidyl Inositol) other membrane anchors (see PTM) other unknown ? Signals found in proteins
SignalP MitoProt ChloroP Predotar PSort TargetP Sigcleave (EMBOSS) Big-PI DGPI Signals detection tools
Detection (signal peptide, hydropathy, helices) Organisation (topology) Transmembrane regions
TMHMM TMPred TopPred2 DAS HMMTop Tmap (EMBOSS) Transmembrane detection tools
Phosphorylation S - T - Y N-glycosylation N O-glycosylation S - T - (HO)K Acetylation, methylation D - E - K Sulfation Y Farnesylation, myristylation, palmitoylation, geranylgeranylation, GPI-anchor C - Nter - Cter Ubiquitination and family K - Nter Inteins (protein splicing) Pre-translational Selenoprotein C Post translational modifications
Pattern prediction (PROSITE) Short or weak signal Frequent hit producer Best method is experimental MS/MS detection Most method use « rules » joining pattern detection and knowledge to predict sites. NetOGlyc - Prediction of type O-glycosylation sites in mammalian proteins DictyOGlyc - Prediction of GlcNAc O-glycosylation sites in Dictyostelium YinOYang - O-beta-GlcNAc attachment sites in eukaryotic protein sequences NetPhos - Prediction of Ser, Thr and Tyr phosphorylation sites in eukaryotic proteins NMT - Prediction of N-terminal N-myristoylation Sulfinator - Prediction of tyrosine sulfation sites PTM detection
repeats compositional bias PEST Low complexity regions
DUST (DNA) / SEG de novo detection RepeatMasker (DNA) search collection REP search collection REPRO, Radar de novo detection PEST, PESTFind de novo detection EMBOSS (DNA) einverted equicktandem etandem palindrome EMBOSS (protein) oddcomp Low complexity / Repeats
Helix of helix coiled-coil Leu-zipper Coils
COILS Weight matrices Paircoil, Multicoil Pairwise correlation Marcoil HMM Pepcoil (EMBOSS) Weight matrices Coils detection
Structure to predict Alpha-helices Beta-sheets Turns Random coil Garnier (EMBOSS) PHD DSC PREDATOR NNSSP Jpred Jnet Many others Secondary structure
Peptides binding to MHC class I 8, 9, 10 mers class II 15 mers (3+9+3) Depend highly on MHC type Use of experimental knowledge Databases of known peptides SYFPEITHI HLA_Bind (BIMAS) MAPPP combined expert Antigenic (EMBOSS) Many more Prediction of proteasome cleavage sites NetChop PaProc Antigenic peptide
All the protein domain descriptors PROSITE PFAM SMART PRODOM BLOCKS PRINTS … Federation: InterPro Many techniques Patterns, Regexp PSSM (PSI-BLAST) Profiles HMM Domain / Motif
You can find some of them on our servers www.ch.embnet.org Or on ExPASy server www.expasy.org/tools Or ask Google!! www.google.com Other Tools
Free Open Source (for most Unix plateforms) • GCG successor (compatible with GCG file format) • More than 150 programs (ver. 2.7.1) • Easy to install locally • but no interface, requires local databases • Unix command-line only • Interfaces • Jemboss, www2gcg, w2h, wemboss… (with account) • Pise, EMBOSS-GUI, SRSWWW (no account) • Staden, Kaptain, CoLiMate, Jemboss (local) • Access: www.emboss.org
Some details • Format USA • 'asis' ::Sequence [start : end : reverse] • Format :: '@' ListFile [start : end : reverse] • Format :: 'list' :ListFile [start : end : reverse] • Format :: Database : Entry [start : end : reverse] • Format :: Database-SearchField:Word [start : end : reverse] • Format :: File : Entry [start : end : reverse] • Format :: File:SearchField:Word [start : end : reverse] • Format :: Program Program-parameters '|' [start : end : reverse] • Example: fasta::Swissprot:UBP5_HUMAN[200:300] • Databases • Any can be added, use showdb to display the available databases
databases • showdb Displays information on the currently available databases # Name Type ID Qry All Comment # ==== ==== == === === ======= ipr_fetch P OK OK OK InterPro current by fetch ipi_fetch P OK OK OK IPI current by fetch refseq_fetch P OK OK OK refseq current by fetch repbase_fetch P OK OK OK repbase current by fetch swiss_fetch P OK OK OK SwissProt current by fetch swissprot P OK OK OK SWISSPROT sequences trembl P OK OK OK TREMBL sequences trembl_fetch P OK OK OK trembl current by fetch tremblnew P OK OK OK TREMBL New sequences ug_fetch P OK OK OK Unigene by fetch embl N OK OK OK EMBL release emhum N OK OK OK EMBL release, Human section by emboss index emrod N OK OK OK EMBL release, Rodent section by emboss index emvrt N OK OK OK EMBL release, Vertebrate (nonhuman, nonrodent) • seqret (seqretall, seqretset, seqretsplit) • entret (for complete untouched entry, e.g., for unigene, interpro, swissprot…) • Possible to define your own « .embossrc » file
Some tools for DNA • redata Search REBASE for enzyme name, references, suppliers etc • remap Display a sequence with restriction cut sites, translation etc • restover Finds restriction enzymes that produce a specific overhang • restrict Finds restriction enzyme cleavage sites • showseq Display a sequence with features, translation etc • silent Silent mutation restriction enzyme scan • cirdna Draws circular maps of DNA constructs • lindna Draws linear maps of DNA constructs • revseq Reverse and complement a sequence • …
Example: remap ECLAC E.coli lactose operon with lacI, lacZ, lacY and lacA genes. Hin6I TaqI | HhaI | Bsc4I | Bsu6I | | Hin6I | BssKI | | | HhaI AciI | | BsiSI \ \ \ \ \ \ \ \ GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA / / / / / / / /// | TaqI | Hin6I AciI | | ||BssKI Bsc4I HhaI | | |BsiSI | | Bsu6I | Hin6I HhaI # Enzymes that cut Frequency Isoschizomers AciI 1 Bsc4I 1 BsiSI 1 BssKI 1 Bsu6I 1 HhaI 2 Hin6I 2 HinP1I,HspAI TaqI 1 # Enzymes that do not cut AclI BamHI BceAI Bse1I BshI ClaI EcoRI EcoRII Hin4I HindII HindIII HpyCH4IV KpnI NotI
Example: cirdna • File: ../../data/data.cirp Start 1001 End 4270 group label Block 1011 1362 3 ex1 endlabel label Tick 1610 8 EcoR1 endlabel label Block 1647 1815 1 endlabel label Tick 2459 8 BamH1 endlabel label Block 4139 4258 3 ex2 endlabel endgroup group label Range 2541 2812 [ ] 5 Alu endlabel label Range 3322 3497 > < 5 MER13 endlabel endgroup
EMBOSS format input/output • UFO Universal Feature Object • gff, swissprot, embl, pir, nbrf (with or without sequence) • Alignments • Multiple and pairwise, many flavors (FASTA, MSF, SRS…) • Reports • Feature (UFO), SRS, motif, seqtable, excel, diffseq, listfile (USA), etc… • Sequences (compatible with USA) • Many!!! E.g., fasta, clustal, gcg, paup, gff, embl, swissprot, acedb, abi, etc…
Web interfaces • PISE (Pasteur Institute Software Environment) • http://www-alt.pasteur.fr/~letondal/Pise/ • EMBOSS-GUI (Canada) (not yet at SIB) • http://bioinfo.pbi.nrc.ca/~lukem/EMBOSS/
http://emboss.ch.embnet.org/Pise Pise a tool to generate Web interfaces for Molecular Biology programs
GUI (Canada) http://bioinfo.pbi.nrc.ca:8090/EMBOSS/
Launch Jemboss http://emboss.ch.embnet.org/Jemboss
Launch Jemboss First time only… Each time…
Summary • Anonymous web access through Pise • Registered access through Jemboss • Registered access through command-line (requires UNIX skills) • Please report problems!
DEA Exercises web based sequence analysis The goal of this exercise is to use web based tools for protein sequence analysis a) Take this TrEMBL sequence (Q9X252) and try a BLAST against swissprot with the complete protein or with the first 70 residues. Explain the difference. Use TMPred, SignalP, and COILS to help you. b) Pass this sequence through PFSCAN and search all databases. Compare with this command on ludwig-sun1/2:hits -b "prf pat pfam" tr:Q9X252 c) use the different profile, motifs, pattern databases to get more information about the domain(s) you found. d) How do you evaluate the PRINTS tropomyosin annotation in this TrEMBL entry (Q9WZH0)? List of useful links: basic BLAST or advanced BLAST or PSI-BLAST TMPred prediction tool for transmembrane regions (or TMHMM) COILS prediction tool for coiled-coil regions SignalP prediction tool for signal-peptide cleavage site Profile, domain, motifs databases and search sites: PFSCAN InterPro (Pfam, PRINTS, PROSITE,SMART) HITS Exercises