1 / 59

Processes of Evolution

This segment explores various processes of evolution focusing on examples like predation and the adaptation of species, such as rock-pocket mice and peppered moths. It discusses how selective pressures, like night-flying owls, can shift allele frequencies through natural selection. The chapter also highlights the role of fossils in revealing evolutionary relationships, the importance of biochemical evidence, and the significance of homologous and analogous structures in understanding shared ancestry. Additionally, it covers dating methods and speciation processes in diverse environments.

liv
Download Presentation

Processes of Evolution

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 8 part 2 Processes of Evolution

  2. Fig. 18-5a, p. 282

  3. Fig. 18-5b, p. 282

  4. Fig. 18-5c, p. 282

  5. Predation and Peppered Moths

  6. Predation and Rock-Pocket Mice • In rock-pocket mice, two alleles of a single gene control coat color • Night-flying owls are the selective pressure that directionally shifts the allele frequency

  7. Stabilizing Selection Number of individuals in population Time 1 Range of values for the trait Time 2 Time 3 Stepped Art Fig. 18-8, p. 284

  8. Fig. 18-10a, p. 285

  9. Fig. 18-10b, p. 285

  10. Fig. 18-10c, p. 285

  11. Evidence of Evolution • Biogeography • Fossils/geology • Anatomy • Homologous structures • Analogous structures • embryos • Vestigial structures • Genetics • Biochemistry

  12. Patterns in Biogeography

  13. Geography Marsupials evolution.berkeley.edu/evosite/lines/IVCexperiments.shtml en.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg

  14. A 420 mya B 237 mya C 152 mya D 65.5 mya E 14 mya Fig. 17-17, p. 273

  15. About Fossils • Fossils are remnants or traces of organisms that lived in the past • give us clues about evolutionary relationships • The fossil record will always be incomplete

  16. Fossils Remains of bones, teeth, shells, seeds, spores, or other body parts Trace fossils Evidence of an organism’s activities (nests, trails, footprints, burrows, bore holes, eggshells, feces) Fossils

  17. Fossils

  18. Transitional fossils • Many fossils show a clear transition from one species, or group, to another. Archaeopteryx http://chem.tufts.edu/science/evolution/horseevolution.htm http://www.talkorigins.org/faqs/faq-transitional/part2a.html http://evolution.berkeley.edu/evolibrary/article/lines_03 http://evolution.berkeley.edu/evolibrary/home.php

  19. Dating Pieces of the Puzzle • Radiometric dating • Ex: uranium 238 →lead 206 • Half-life • time it takes for half of a radioisotope’s atoms to decay into a daughter element

  20. parent isotope newly formed rock daughter isotope after one half-life after two half-lives Stepped Art Fig. 17-11, p. 268

  21. Fig. 17-14a, p. 270

  22. Fig. 17-14b, p. 271

  23. Homologous structures Similar body parts that reflect shared ancestry The same genes direct their development Anatomy- comparative morphology

  24. Analogous structures • Body parts that evolved independently in separate lineages in response to the same environmental pressure

  25. As evolution progresses, some structures get side-lined as they are not longer of use. Vestigial Structures coccyx limb bud Fig. 17-3, p. 261

  26. Anatomy-embryos • Embryos of many vertebrate species develop in similar ways

  27. Antibiotic resistance Staphylococcus • This is an example of natural selection in action. The antibiotic acts as an environmental pressure.

  28. Biochemistry DNA for Information Transfer ATP for Energy Transfer

  29. Similar Genes HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA Genetic code of chimps and gorillas is almost identical to humans

  30. Comparing Cytochrome b Sequences

  31. A Whale of a Story • New fossil discoveries are continually filling the gaps in our understanding of the ancient history of many lineages

  32. New Links in the Ancient Lineage of Whales

  33. New Links in the Ancient Lineage of Whales

  34. Reproductive Isolation • Speciation • Evolutionary process by which new species form • Biological species concept- species are populations of organisms that interbreed under natural conditions

  35. Allopatric Speciation

  36. The Inviting Archipelagos A A few individuals of a mainland species reach isolated island 1. In the new habitat, populations of their descendants diverge, and speciation occurs. B Later, a few individuals of a new species colonize nearby island 2. Speciation follows genetic divergence in the new habitat. C Genetically different descendants of the ancestral species may colonize islands 3 and 4 or even invade island 1. Genetic divergence and speciation may follow. Fig. 18-21a, p. 293

More Related