slide1
Download
Skip this Video
Download Presentation
From Gene to Protein

Loading in 2 Seconds...

play fullscreen
1 / 46

From Gene to Protein - PowerPoint PPT Presentation


  • 55 Views
  • Uploaded on

From Gene to Protein. How Genes Work. What do genes code for?. How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA. DNA. proteins. cells. bodies. The “Central Dogma”. Flow of genetic information in a cell

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' From Gene to Protein' - linus-levy


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1
From Gene to Protein

How Genes Work

what do genes code for
What do genes code for?
  • How does DNA code for cells & bodies?
    • how are cells and bodies made from the instructions in DNA

DNA

proteins

cells

bodies

the central dogma
The “Central Dogma”
  • Flow of genetic information in a cell
    • How do we move information from DNA to proteins?

transcription

translation

RNA

DNA

protein

trait

DNA gets all the glory, but proteins do all the work!

replication

metabolism taught us about genes
A

B

C

D

E

disease

disease

disease

disease

Metabolism taught us about genes
  • Inheritance of metabolic diseases
    • suggested that genes coded for enzymes
    • each disease (phenotype) is caused by non-functional gene product
      • lack of an enzyme
      • Tay sachs
      • PKU (phenylketonuria)
      • albinism

Am I just the sum of my proteins?

metabolic pathway

enzyme 1

enzyme 2

enzyme 3

enzyme 4

beadle tatum
1941 | 1958Beadle & Tatum

one gene : one enzyme hypothesis

George Beadle

Edward Tatum

"for their discovery that genes act by regulating definite chemical events"

slide6
X rays or ultraviolet light

Wild-type

Neurospora

asexual

spores

Minimal

medium

Growth on

complete

medium

spores

Select one of

the spores

Grow on

complete medium

Test on minimal

medium to confirm

presence of mutation

Minimal media supplemented only with…

Choline

Pyridoxine

Riboflavin

Minimal

control

Nucleic

acid

Arginine

Niacin

Inositol

Folic

acid

p-Amino

benzoic acid

Thiamine

Beadle & Tatum

create mutations

positive control

negative control

mutation identified

experimentals

amino acidsupplements

from gene to protein
aa

aa

aa

aa

aa

ribosome

aa

aa

aa

aa

aa

aa

From gene to protein

nucleus

cytoplasm

transcription

translation

DNA

mRNA

protein

trait

transcription

Transcription

fromDNA nucleic acid languagetoRNA nucleic acid language

slide9
RNA
  • ribose sugar
  • N-bases
    • uracil instead of thymine
    • U : A
    • C : G
  • single stranded
  • lots of RNAs
    • mRNA, tRNA, rRNA, siRNA…

transcription

DNA

RNA

transcription1
Transcription
  • Making mRNA
    • transcribed DNA strand = template strand
    • untranscribed DNA strand = coding strand
      • same sequence as RNA
    • synthesis of complementary RNA strand
      • transcription bubble
    • enzyme
      • RNA polymerase

coding strand

3

A

G

C

A

T

C

G

T

5

A

G

A

A

A

C

G

T

T

T

T

C

A

T

C

G

A

C

T

DNA

3

C

T

G

A

A

5

T

G

G

C

A

U

C

G

U

T

C

unwinding

3

G

T

A

G

C

A

rewinding

mRNA

template strand

RNA polymerase

5

build RNA 53

rna polymerases
RNA polymerases
  • 3 RNA polymerase enzymes
    • RNA polymerase 1
      • only transcribes rRNA genes
      • makes ribosomes
    • RNA polymerase 2
      • transcribes genes into mRNA
    • RNA polymerase 3
      • only transcribes tRNA genes
    • each has a specific promoter sequence it recognizes
which gene is read
Which gene is read?
  • Promoter region
    • binding site before beginning of gene
    • TATA box binding site
    • binding site for RNA polymerase & transcription factors
  • Enhancer region
    • binding site far upstream of gene
      • turns transcription on HIGH
transcription factors
Transcription Factors
  • Initiation complex
    • transcription factors bind to promoter region
      • suite of proteins which bind to DNA
      • hormones?
      • turn on or off transcription
    • trigger the binding of RNA polymerase to DNA
matching bases of dna rna
RNA

polymerase

Matching bases of DNA & RNA

A

  • Match RNA bases to DNA bases on one of the DNA strands

C

U

G

A

G

G

U

C

U

U

G

C

A

C

A

U

A

G

A

C

U

A

5'

3'

G

C

C

A

T

G

G

T

A

C

A

G

C

T

A

G

T

C

A

T

C

G

T

A

C

C

G

T

eukaryotic genes have junk
intron = noncoding (inbetween) sequence

exon = coding (expressed) sequence

Eukaryotic genes have junk!
  • Eukaryotic genes are not continuous
    • exons = the real gene
      • expressed / coding DNA
    • introns = the junk
      • inbetween sequence

intronscome out!

eukaryotic DNA

mrna splicing
intron = noncoding (inbetween) sequence

exon = coding (expressed) sequence

mRNA splicing
  • Post-transcriptional processing
    • eukaryotic mRNA needs work after transcription
    • primary transcript = pre-mRNA
    • mRNA splicing
      • edit out introns
    • make mature mRNA transcript

~10,000 bases

eukaryotic DNA

pre-mRNA

primary mRNA

transcript

~1,000 bases

mature mRNA

transcript

spliced mRNA

discovery of exons introns
1977 | 1993Discovery of exons/introns

Richard Roberts

Philip Sharp

adenovirus

CSHL

MIT

common cold

beta-thalassemia

splicing must be accurate
Splicing must be accurate
  • No room for mistakes!
    • a single base added or lost throws off the reading frame

AUGCGGCTATGGGUCCGAUAAGGGCCAU

AUGCGGUCCGAUAAGGGCCAU

AUG|CGG|UCC|GAU|AAG|GGC|CAU

Met|Arg|Ser|Asp|Lys|Gly|His

AUGCGGCTATGGGUCCGAUAAGGGCCAU

AUGCGGGUCCGAUAAGGGCCAU

AUG|CGG|GUC|CGA|UAA|GGG|CCA|U

Met|Arg|Val|Arg|STOP|

rna splicing enzymes
snRNPs

snRNA

intron

exon

exon

5'

3'

spliceosome

5'

3'

lariat

5'

3'

exon

exon

mature mRNA

excised

intron

5'

3'

Whoa! I think

we just brokea biological “rule”!

RNA splicing enzymes
  • snRNPs
    • small nuclear RNA
    • proteins
  • Spliceosome
    • several snRNPs
    • recognize splice site sequence
      • cut & paste gene

No, not smurfs!

“snurps”

alternative splicing
Alternative splicing
  • Alternative mRNAs produced from same gene
    • when is an intron not an intron…
    • different segments treated as exons

Starting to gethard to define a gene!

more post transcriptional processing
3' poly-A tail

3'

A

A

A

A

A

mRNA

50-250 A’s

5' cap

P

P

P

5'

G

More post-transcriptional processing
  • Need to protect mRNA on its trip from nucleus to cytoplasm
    • enzymes in cytoplasm attack mRNA
      • protect the ends of the molecule
      • add 5 GTP cap
      • add poly-A tail
        • longer tail, mRNA lasts longer: produces more protein
from gene to protein1
aa

aa

aa

aa

aa

ribosome

aa

aa

aa

aa

aa

aa

From gene to protein

nucleus

cytoplasm

transcription

translation

DNA

mRNA

protein

trait

translation

Translation

fromnucleic acid languagetoamino acid language

how does mrna code for proteins
TACGCACATTTACGTACGCGG

DNA

AUGCGUGUAAAUGCAUGCGCC

mRNA

MetArgValAsnAlaCysAla

protein

?

How does mRNA code for proteins?

How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

4

ATCG

4

AUCG

20

mrna codes for proteins in triplets
TACGCACATTTACGTACGCGG

DNA

AUGCGUGUAAAUGCAUGCGCC

mRNA

AUGCGUGUAAAUGCAUGCGCC

mRNA

codon

MetArgValAsnAlaCysAla

protein

?

mRNA codes for proteins in triplets
cracking the code
1960 | 1968Cracking the code

Nirenberg & Khorana

  • Crick
    • determined 3-letter (triplet) codon system

WHYDIDTHEREDBATEATTHEFATRAT

WHYDIDTHEREDBATEATTHEFATRAT

  • Nirenberg (47) & Khorana (17)
    • determined mRNA–amino acid match
    • added fabricated mRNA to test tube of ribosomes, tRNA & amino acids
      • created artificial UUUUU… mRNA
      • found that UUU coded for phenylalanine
slide27
1960 | 1968

Marshall Nirenberg

Har Khorana

the code
The code
  • Code for ALL life!
    • strongest support for a common origin for all life
  • Code is redundant
    • several codons for each amino acid
    • 3rd base “wobble”

Why is thewobble good?

  • Start codon
    • AUG
    • methionine
  • Stop codons
    • UGA, UAA, UAG
how are the codons matched to amino acids
GCA

UAC

CAU

Met

Arg

Val

How are the codons matched to amino acids?

3

5

TACGCACATTTACGTACGCGG

DNA

5

3

AUGCGUGUAAAUGCAUGCGCC

mRNA

codon

3

5

tRNA

anti-codon

aminoacid

from gene to protein2
aa

aa

aa

aa

aa

ribosome

aa

aa

aa

aa

aa

aa

From gene to protein

nucleus

cytoplasm

transcription

translation

DNA

mRNA

protein

trait

transfer rna structure
Transfer RNA structure
  • “Clover leaf” structure
    • anticodon on “clover leaf” end
    • amino acid attached on 3 end
loading trna
Loading tRNA
  • Aminoacyl tRNA synthetase
    • enzyme which bonds amino acid to tRNA
    • bond requires energy
      • ATP  AMP
      • bond is unstable
      • so it can release amino acid at ribosome easily

Trp

C=O

Trp

Trp

C=O

H2O

OH

O

OH

C=O

O

activating

enzyme

tRNATrp

A

C

C

mRNA

U

G

G

anticodon

tryptophan attached to tRNATrp

tRNATrp binds to UGG condon of mRNA

ribosomes
Ribosomes
  • Facilitate coupling of tRNA anticodon to mRNA codon
    • organelle or enzyme?
  • Structure
    • ribosomal RNA (rRNA) & proteins
    • 2 subunits
      • large
      • small

E

P

A

ribosomes1
Ribosomes
  • A site (aminoacyl-tRNA site)
    • holds tRNA carrying next amino acid to be added to chain
  • P site (peptidyl-tRNA site)
    • holds tRNA carrying growing polypeptide chain
  • E site (exit site)
    • empty tRNA leaves ribosome from exit site

Met

C

A

U

5'

G

U

A

3'

E

P

A

building a polypeptide
3

2

1

Building a polypeptide
  • Initiation
    • brings together mRNA, ribosome subunits, initiator tRNA
  • Elongation
    • adding amino acids based on codon sequence
  • Termination
    • end codon

release

factor

Leu

Val

Ser

Met

Met

Ala

Leu

Met

Met

Leu

Leu

Trp

tRNA

C

A

G

C

G

A

C

C

C

A

A

G

A

G

C

U

A

C

C

A

U

A

U

U

A

U

G

A

A

5'

5'

A

A

5'

C

U

U

5'

A

A

G

G

A

G

U

U

G

U

C

U

U

U

G

C

A

C

U

3'

G

G

U

A

A

U

A

A

C

C

mRNA

3'

3'

3'

U

G

G

U

A

A

3'

E

P

A

protein targeting
Destinations:
    • secretion
    • nucleus
    • mitochondria
    • chloroplasts
    • cell membrane
    • cytoplasm
    • etc…
Protein targeting
  • Signal peptide
    • address label

start of a secretory pathway

slide37
RNA polymerase

DNA

Can you tell the story?

aminoacids

exon

intron

tRNA

pre-mRNA

5' GTP cap

mature mRNA

aminoacyl tRNAsynthetase

poly-A tail

3'

large ribosomal subunit

polypeptide

5'

tRNA

small ribosomal subunit

E

P

A

ribosome

the transcriptional unit gene
enhancer

translation

start

translation

stop

exons

1000+b

20-30b

RNA

polymerase

DNA

UTR

UTR

introns

promoter

transcription

start

transcription

stop

pre-mRNA

5'

3'

5'

3'

mature mRNA

The Transcriptional unit (gene?)

transcriptional unit (gene)

3'

5'

TAC

ACT

TATA

DNA

GTP

AAAAAAAA

protein synthesis in prokaryotes
Bacterial chromosome

Protein Synthesis in Prokaryotes

Transcription

mRNA

Psssst…no nucleus!

Cell

membrane

Cell wall

prokaryote vs eukaryote genes
Prokaryotes

DNA in cytoplasm

circular chromosome

naked DNA

no introns

Eukaryotes

DNA in nucleus

linear chromosomes

DNA wound on histone proteins

introns vs. exons

intron = noncoding (inbetween) sequence

exon = coding (expressed) sequence

Prokaryote vs. Eukaryote genes

intronscome out!

eukaryotic

DNA

translation in prokaryotes
Translation in Prokaryotes
  • Transcription & translation are simultaneous in bacteria
    • DNA is in cytoplasm
    • no mRNA editing
    • ribosomesread mRNA as it is being transcribed
translation prokaryotes vs eukaryotes
Translation: prokaryotes vs. eukaryotes
  • Differences between prokaryotes & eukaryotes
    • time & physical separation between processes
      • takes eukaryote ~1 hour from DNA to protein
    • no RNA processing
slide43
Any Questions??

What color would a smurf turnif he held his breath?

the transcriptional unit
enhancer

1000+b

20-30b

RNA

polymerase

5'

3'

5'

3'

The Transcriptional unit

exons

transcriptional unit

3'

5'

TAC

ACT

TATA

DNA

introns

ad