slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
MW  11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu PowerPoint Presentation
Download Presentation
MW  11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu

Loading in 2 Seconds...

play fullscreen
1 / 26

MW  11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu - PowerPoint PPT Presentation


  • 90 Views
  • Uploaded on

CS173. Lecture 9: Transcriptional regulation III. MW  11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu. Announcements. Halfway feedback end of class today Undergrads: CURIS in summer .

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'MW  11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu' - linh


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

CS173

Lecture 9: Transcriptional regulation III

MW  11:00-12:15 in Beckman B302

Prof: Gill Bejerano

TAs: Jim Notwell & Harendra Guturu

http://cs173.stanford.edu [BejeranoWinter12/13]

announcements
Announcements
  • Halfway feedback end of class today
  • Undergrads: CURIS in summer

http://cs173.stanford.edu [BejeranoWinter12/13]

slide3

TTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTCAGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAAAAGCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAATGACTAAATCTCATTCAGAAGAAGTGATTGTACCTGAGTTCAATTCTAGCGCAAAGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGGATTTTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTATTGATTTTGATATGCTTTGCGCCGTCAAAGTTTTGAACGATGAGATTTCAAGTCTTAAAGCTATATCAGAGGGCTAAGCATGTGTATTCTGAATCTTTAAGAGTCTTGAAGGCTGTGAAATTAATGACTACAGCGAGCTTTACTGCCGACGAAGACTTTTTCAAGCAATTTGGTGCCTTGATGAACGAGTCTCAAGCTTCTTGCGATAAACTTTACGAATGTTCTTGTCCAGAGATTGACAAAATTTGTTCCATTGCTTTGTCAAATGGATCATATGGTTCCCGTTTGACCGGAGCTGGCTGGGGTGGTTGTACTGTTCACTTGGTTCCAGGGGGCCCAAATGGCAACATAGAAAAGGTAAAAGAAGCCCTTGCCAATGAGTTCTACAAGGTCAAGTACCCTAAGATCACTGATGCTGAGCTAGAAAATGCTATCATCGTCTCTAAACCAGCATTGGGCAGCTGTCTATATGAATTAGTCAAGTATACTTCTTTTTTTTACTTTGTTCAGAACAACTTCTCATTTTTTTCTACTCATAACTTTAGCATCACAAAATACGCAATAATAACGAGTAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATACCTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTTGCGAAGTTCTTGGCAAGTTGCCAACTGACGAGATGCAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATACCTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAGTTCTTGGCAAGTTGCCAACTGACGAGATGCAGTTTCCTACGCATAATAAGAATAGGAGGGAATATCAAGCCAGACAATCTATCATTACATTTAAGCGGCTCTTCAAAAAGATTGAACTCTCGCCAACTTATGGAATCTTCCAATGAGACCTTTGCGCCAAATAATGTGGATTTGGAAAAAGAGTATAAGTCATCTCAGAGTAATATAACTACCGAAGTTTATGAGGCATCGAGCTTTGAAGAAAAAGTAAGCTCAGAAAAACCTCAATACAGCTCATTCTGGAAGAAAATCTATTATGAATATGTGGTCGTTGACAAATCAATCTTGGGTGTTTCTATTCTGGATTCATTTATGTACAACCAGGACTTGAAGCCCGTCGAAAAAGAAAGGCGGGTTTGGTCCTGGTACAATTATTGTTACTTCTGGCTTGCTGAATGTTTCAATATCAACACTTGGCAAATTGCAGCTACAGGTCTACAACTGGGTCTAAATTGGTGGCAGTGTTGGATAACAATTTGGATTGGGTACGGTTTCGTTGGTGCTTTTGTTGTTTTGGCCTCTAGAGTTGGATCTGCTTATCATTTGTCATTCCCTATATCATCTAGAGCATCATTCGGTATTTTCTTCTCTTTATGGCCCGTTATTAACAGAGTCGTCATGGCCATCGTTTGGTATAGTGTCCAAGCTTATATTGCGGCAACTCCCGTATCATTAATGCTGAAATCTATCTTTGGAAAAGATTTACAATGATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAGTTCTTGGCAAGTTGCCAACTGACGAGATGCAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATACCTATTCTTGACATGATATGACTACCATTTTGTTATTGTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATAAAGTTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTCAGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAAAAGCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAATGACTAAATCTCATTCAGAAGAAGTGATTGTACCTGAGTTCAATTCTAGCGCAAAGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGGATTTTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTATTGATTTTGATATGCTTTGCGCCGTCAAAGTTTTGAACGATGAGATTTCAAGTCTTAAAGCTATATCAGAGGGCTAAGCATGTGTATTCTGAATCTTTAAGAGTCTTGAAGGCTGTGAAATTAATGACTACAGCGAGCTTTACTGCCGACGAAGACTTTTTCAAGCAATTTGGTGCCTTGATGAACGAGTCTCAAGCTTCTTGCGATAAACTTTACGAATGTTCTTGTCCAGAGATTGACAAAATTTGTTCCATTGCTTTGTCAAATGGATCATATGGTTCCCGTTTGACCGGAGCTGGCTGGGGTGGTTGTACTGTTCACTTGGTTCCAGGGGGCCCAAATGGCAACATAGAAAAGGTAAAAGAAGCCCTTGCCAATGAGTTCTACAAGGTCAAGTACCCTAAGATCACTGATGCTGAGCTAGAAAATGCTATCATCGTCTCTAAACCAGCATTGGGCAGCTGTCTATATGAATTAGTCAAGTATACTTCTTTTTTTTACTTTGTTCAGAACAACTTCTCATTTTTTTCTACTCATAACTTTAGCATCACAAAATACGCAATAATAACGAGTAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATACCTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTTGCGAAGTTCTTGGCAAGTTGCCAACTGACGAGATGCAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATACCTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAGTTCTTGGCAAGTTGCCAACTGACGAGATGCAGTTTCCTACGCATAATAAGAATAGGAGGGAATATCAAGCCAGACAATCTATCATTACATTTAAGCGGCTCTTCAAAAAGATTGAACTCTCGCCAACTTATGGAATCTTCCAATGAGACCTTTGCGCCAAATAATGTGGATTTGGAAAAAGAGTATAAGTCATCTCAGAGTAATATAACTACCGAAGTTTATGAGGCATCGAGCTTTGAAGAAAAAGTAAGCTCAGAAAAACCTCAATACAGCTCATTCTGGAAGAAAATCTATTATGAATATGTGGTCGTTGACAAATCAATCTTGGGTGTTTCTATTCTGGATTCATTTATGTACAACCAGGACTTGAAGCCCGTCGAAAAAGAAAGGCGGGTTTGGTCCTGGTACAATTATTGTTACTTCTGGCTTGCTGAATGTTTCAATATCAACACTTGGCAAATTGCAGCTACAGGTCTACAACTGGGTCTAAATTGGTGGCAGTGTTGGATAACAATTTGGATTGGGTACGGTTTCGTTGGTGCTTTTGTTGTTTTGGCCTCTAGAGTTGGATCTGCTTATCATTTGTCATTCCCTATATCATCTAGAGCATCATTCGGTATTTTCTTCTCTTTATGGCCCGTTATTAACAGAGTCGTCATGGCCATCGTTTGGTATAGTGTCCAAGCTTATATTGCGGCAACTCCCGTATCATTAATGCTGAAATCTATCTTTGGAAAAGATTTACAATGATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAGTTCTTGGCAAGTTGCCAACTGACGAGATGCAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATACCTATTCTTGACATGATATGACTACCATTTTGTTATTGTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATAAAG

Genome Content

http://cs173.stanford.edu [BejeranoWinter12/13]

slide4

Transcription Regulation

http://cs173.stanford.edu [BejeranoWinter12/13]

gene regulation
Gene Regulation

Some proteins and non coding RNAs go “back” to bind DNA near genes, turning these genes on and off.

http://cs173.stanford.edu [BejeranoWinter12/13]

transcription activation
Transcription Activation

Terminology:

  • RNA polymerase
  • Transcription Factor
  • Transcription Factor Binding Site
  • Promoter
  • Enhancer
  • Gene Regulatory Domain

TF

DNA

http://cs173.stanford.edu [BejeranoWinter12/13]

transcriptional repression
Transcriptional Repression
  • Transcription factors can bind key genomic sites, preventing/repelling the binding of
    • The RNA polymerase machinery
    • Activating transcription factors
  • DNA can be bent into 3D shape preventing enhancer – promoter interactions.
  • Activator and co-activator proteins can be modified into inactive states.

Activation and repression counter-act to provide the cell the needed levels of output from the same stretch of DNA under the many cellular conditions all served by (identical copies of) the same genome.

http://cs173.stanford.edu [BejeranoWinter12/13]

locus control region
Locus Control Region

http://cs173.stanford.edu [BejeranoWinter12/13]

slide9

Nucleosomes, Histones, Transcription

Chromatin / Proteins

Genome packaging provides a critical layer of gene regulation.

DNA / Proteins

http://cs173.stanford.edu [BejeranoWinter12/13]

chromosome centromere
Chromosome Centromere

Centromere:

region of DNA typically found near the middle of a chromosome where two identical sister chromatids come in contact. It is involved in cell division

http://cs173.stanford.edu [BejeranoWinter12/13]

heterochromatin euchromatin
Heterochromatin & Euchromatin

Heterochromatin:

Tightly coiled chromosome material; believed to be mostly genetically inactive.

Euchromatin:

Where temporal opening and closing of chromatin (“nucleosome positioning”) and transcription takes place.

http://cs173.stanford.edu [BejeranoWinter12/13]

insulators
Insulators

Insulators are DNA sequences that when placed between target gene and enhancer prevent enhancer from acting on the gene.

  • Known insulators contain binding sites for a specific DNA binding protein (CTCF) that is involved in DNA 3D conformation.
  • However, CTCF fulfills additional roles besides insulation. I.e, the presence of a CTCF site does not ensure that a genomic region acts as an insulator.

TSS2

TSS1

Insulator

http://cs173.stanford.edu [BejeranoWinter12/13]

signal transduction
Signal Transduction
  • Everything we discussed so far happens within the cell.
  • But cells talk to each other, copiously.

http://cs173.stanford.edu [BejeranoWinter12/13]

enhancers as integrators
Enhancers as Integrators

IF the cell ispart of a certain tissueANDreceives a certain signal

THEN turn Gene ON

Gene

http://cs173.stanford.edu [BejeranoWinter12/13]

slide15

Gene Regulation

Chromatin / Proteins

Extracellular signals

DNA / Proteins

http://cs173.stanford.edu [BejeranoWinter12/13]

slide16

Histone Tails, Histone Marks

DNA is wrapped around nucleosomes.

Nucleosomes are made of histones.

Histones have free tails.

Residues in the tails are modified in specific patterns in conjunction with specific gene regulation activity.

http://cs173.stanford.edu [BejeranoWinter12/13]

histone mark correlation examples
Histone Mark Correlation Examples
  • Active gene promoters are marked by H3K4me3
  • Silenced gene promoters are marked by H3K27me3
  • p300, a protein component of many active enhancers acetylates H3k27Ac.

http://cs173.stanford.edu [BejeranoWinter12/13]

measuring these different states
Measuring these different states

Note that the DNA itself doesn’t change. We sequence different portions of it thatare currently in different states (bound by a TF, wrapped around a nucleosome etc.)

http://cs173.stanford.edu [BejeranoWinter12/13]

epigenomics study all these marks genomewide
Epigenomics: study all these marks genomewide

Translate observationsinto current genome state.

http://cs173.stanford.edu [BejeranoWinter12/13]

obtain a network of all active genes dna
Obtain a network of all active genes & DNA

Now what?(to be revisited)

“Ridicilogram”

http://cs173.stanford.edu [BejeranoWinter12/13]

histone code hypothesis
Histone Code Hypothesis
  • Histone modifications serve to recruit other proteins by specific recognition of the modified histone via protein domains specialized for such purposes, rather than through simply stabilizing or destabilizing the interaction between histone and the underlying DNA.

histonemodification:

writer

eraser

reader

http://cs173.stanford.edu [BejeranoWinter12/13]

cis regulatory components
Cis-Regulatory Components
  • Low level (“atoms”):
  • Promoter motifs (TATA box, etc)
  • Transcription factor binding sites (TFBS)
  • Mid Level:
  • Promoter
  • Enhancers
  • Repressors/silencers
  • Insulators/boundary elements
  • Locus control regions
  • High Level:
  • Epigenomic domains / signatures
  • Gene expression domains
  • Gene regulatory networks

http://cs173.stanford.edu [BejeranoWinter12/13]

epigenomics is not epigenetics
Epigenomics is not Epigenetics
  • Epigenetics is the study of heritable changes in gene expression or cellular phenotype, caused by mechanisms other than changes in the underlying DNA sequence
  • There are objections to the use of the term epigenetic to describe chemical modification of histone, since it remains unknown whether or not these modifications are heritable.

http://cs173.stanford.edu [BejeranoWinter12/13]

almost done with genome content function
Almost done with genome content & function
  • We’ve talked about transcripts and their regulation.
  • We’re still ignore at least half the genome…

http://cs173.stanford.edu [BejeranoWinter12/13]

slide25

To be continued

http://cs173.stanford.edu [BejeranoWinter12/13]

slide26

Halfway Feedback

Thank you!

http://cs173.stanford.edu [BejeranoWinter12/13]