Cellulophaga lytica : the “Microbial Mascot” of Northwestern College

1. Cellulophagalytica: the “Microbial Mascot” of Northwestern College Joanna Klein, Ph.D. Northwestern Scholarship Symposium May 10, 2013

2. Cellulophaga lytica • Marine bacterium of the CFB group • Isolated from beach mud near Limon, Costa Rica in 1969 http://travel.yahoo.com/p-travelguide-482616-limon_vacations-i http://www.infoplease.com/atlas/centralamerica.html

3. Cellulophaga lytica • Gram negative • Filamentous • Yellow pigmentation • Exhibits gliding motility • Degrades cellulose

4. Cellulophaga lytica • Target organism in the Genomic Encyclopedia of Bacteria and Archaea (GEBA) Research Program of the Department of Energy/Joint Genome Institute • GEBA organisms • 100 representative organisms from each of the branches • Organisms with potential energy applications

5. C. lytica: Northwestern’s “microbial mascot” • Interpret a genome for education JGI Genome Annotation Workshop, Walnut Creek, CA, January 2011

6. Why study C. lytica? • Model organism to understand the CFB group better • Contribute to biofuel research and applications • Unique method of motility: Gliding

7. Biofuel production • C. lyticaproduces a variety of enzymes that may have applications in biotechnology and biofuel production

8. Ethanol production • Ethanol produced as a byproduct of starch degradation and subsequent fermentation • Well developed technology • Enzymes digest starch into simple sugars which are readily fermented by known microorganisms to produce ethanol • Issues…

9. Cellulosic ethanol production • Goal is to use the cellulose biomass found in plant cell walls of leaves and wood to produce ethanol • Problems to overcome: • Lignin, also found in cell wall, hinders digestion of cellulose from wood • Enzymes that digest cellulose into simple sugars are poorly understood • Organisms that ferment these simple sugars to produce ethanol are poorly understood • Can C. lytichelp achieve this goal? • Predicted to encode 3 cellulase enzymes

10. 3 Cellulase genes of C. lytica • Cellulase 1 • Cellulase 2 • Cellulase 3

11. Plant Cell Wall

12. Cellulase Enzymes in C. lytica • Purpose: To determine if the predicted cellulase enzymes in C. lytica are capable of degrading cellulose. • Method: • Evaluate an assay for cellulose degradation in C. lytica • Transfer a cellulase gene from C. lytica to E. coli, which does not degrade cellulose, and determine if E. coli can now degrade cellulose.

13. Cellulase Degradation Assay - Congo-Red Plate Assay • Grow bacteria on agar plates for 48 hours • Cover with top agar containing 1% carboxymethylcellulose (CMC) and incubate 24 hours • Flood with Congo Red • Congo red binds to CMC • Areas where CMC has been degraded will not be stained – zone of clearance

14. Congo Red Assay: E. coli TOP10 and C. lytica were grown on a TSA plate containing 2% Salt + 1% carboxymethylcellulose. After flooding with Congo Red and fixing the stain, a zone of clearing was observed around C. lytica but not around E. coli.

15. Method • Transfer a cellulase gene from C. lytica to E. coli, which does not degrade cellulose, and determine if E. coli can now degrade cellulose.

16. PCR amplify a cellulase gene from C. lytica • Insert the cellulase gene into the TOPO-TA plasmid • Transfer the recombinant plasmid into E. coli TOP10 • Expresses cellulase enzyme in E. coli • Determine if E. coli can degrade cellulose using the congo red plate assay

17. PCR Amplification PCR amplification of cellulase 1 gene from C. lytica (lane 3)

18. 3 of 5 clones had cellulase activity

19. Fugure Work • Clone 2 remaining cellulase genes and test for activity • Cellulase 3 gene was PCR amplified and cloned into TOPO-TA vector • None of the 10 clones exhibited cellulase activity • Verify correct plasmid construction • Cellulase 2 failed in PCR amplification • Troubleshoot PCR procedure • Perform similar experiments with additional polysaccharide degrading enzymes from C. lytica

20. Gliding motility in C. lytica • Gliding allows bacteria to move across surfaces

21. Gliding Motility in C. lytica

22. Gliding Motility • Research in Flavobacterium indicates over 20 proteins are involved in gliding • cell membrane localization • 6 are lipoproteins • Many make “motor” that propels the cell • sprB is thought to be a surface protein and adhesin propelled along surface by motor

26. Genome Annotation of gliding motility genes of Cellulophagalytica • Genetics students annotated 11 of these predicted gliding motility genes

27. What is annotation? • One way to understand more about the life processes of C. lytica is through a study of its genome. • Genome • All of the genetic material, DNA, of an organism • DNA is made up 4 smaller molecules known as the bases A,C,G &T

29. Genome projects • We can easily determine the entire DNA sequence of an organism – it’s genome. • Currently, there are more than 3000 complete or nearly complete genome sequences of microbes available. • The complete genome of Cellulophaga lytica was sequenced by the DOE and published in 2011 • 3,765,936 bases

30. Genome Projects

31. TATCAAAGAGATGATTGAGAACTGGTACGGAGGGAGTCGAGCCGGGCTCACTTAAGGGCTACGACTTAAC GGGCCGCGTCACTCAATGGCGCGGACACGCCTCTTTGCCCGGGCAGAGGCATGTACAGCGCATGCCCACA ACGGCGGAGGCCGCCGGGTTCCCTGACGTGCCAGTCAGGCCTTCTCCTTTTCCGCAGACCGTGTGTTTCT TTACCGCTCTCCCCCGAGACCTTTTAAGGGTTGTTTGGAGTGTAAGTGGAGGAATATACGTAGTGTTGTC TTAATGGTACCGTTAACTAAGTAAGGAAGCCACTTAATTTAAAATTATGTATGCAGAACATGCGAAGTTA AAAGATGTATAAAAGCTTAAGATGGGGAGAAAAACCTTTTTTCAGAGGGTACTGTGTTACTGTTTTCTTG CTTTTCATTCATTCCAGAAATCATCTGTTCACATCCAAAGGCACAATTCATTTTGAGTTTCTTTCAAAAC AAATCGTTTGTAGTTTTAGGACAGGCTGATGCACTTTGGGCTTGACTTCTGATTACCCTATTGTTAAATT AGTGACCCCTCTTAGTGTTTTCCTGTCCTTTATTTCGGAGGACGCACTTCGAAGATACCAGATTTTATGG GTCATCCTTGGATTTTGAAGCTTATAACTGTGACAAAAAATGTGAAGGGAAGAGATTTGAAACATGTGGA AGGAAAAGTGAGTGCAGACTATAAACTTCCAAAAAGACAAGCCCAAAATACACCTAAACGTTATGTCAGA TTATTTTGTTAAAATCAGTTGTTAGTGACGTCCGTACGTTAATAGAAAAAAGAATGCTTCAGTTTGGAGT GGTAGGTTTCTAGAGGGATTTATTGTGAAAGTATAAACTATTCAGGGCAATGGGACTGAGAGAACAGTGG GTAGAAAGGACCACTGAAGGAAAGGAAGAGAATTGGAAGGTAGATGAAAGAAGGAGCAAGAACCTGGGGTGTTTTTTCCTTTTCACTTGTAATAGTAGTAACAGAAGCAATGGCAGACTGGCTTTTGTTTCTACTGTGT TAGAATGAATTGACAGGACAACTGGGCCTATTATTGTACTGTGCCAGAATACTGTAAAACAAAACTAAAC ATACTAGCTTGGTGGCTTGTAATTAATTACTTAAGTGGAGATTTTTATTTTTTTTTTATTTTTTTTTTAG ACGGAGTCTCACTTTGTCACCCAGGCTGGAGTGCAGTGGCGCGATCTCAGCTGACTGCAACCTCCTCCTC Cellulase

32. Process of annotation • Automatic annotation - done automatically using computer software • 35% of computer generated annotations are wrong or are missing information due to limitations of computer algorithms

33. Manual Annotation – humans analyze the information generated by computers and make corrections as necessary. • Labor intensive and time consuming • Solution: Train students to participate in the process

34. IMG-ACT is a toolkit of online gene and genome analysis programs. • Using IMG-ACT, students annotate genomes • provide human expertise necessary for accurate, up-to-date, reliable annotation • Students contribute to the scientific community and learn biological concepts through participating in original research

35. Annotation of Gliding Motility Genes in C. lytica • The computer based annotation of all 11 genes was confirmed through manual annotation by students

36. Genome annotation of C. lytica at NWC • 64 NWC students have participated in this research project • Science Research Institute, Summer 2011 • Genetics, Fall 2011 • Microbiology, Spring 2012 • Genetics, Fall 2012 • Research Students • 29 genes have been fully annotated • 10 genes have been partially annotated

37. Future work • 3,334 genes left to annotate! • Study the function of interesting genes in the lab

38. Acknowledgements • NWC students who have participated in this research. • Genetics, Microbiology and SRI courses • Research students: Steven Erickson, Andy Jaeger, Silas Baalke, Hannah Bardwell, Rachel Blesi, Trevor Diercks • Funding received from a 2012 Faculty Development Grant to purchase research supplies

39. Questions?