lars
Uploaded by
1 SLIDES
166 VIEWS
10LIKES

Genome Information Lab

DESCRIPTION

Luc. Luc. Luc. Luc. Luc. Luc. structure. U3. R U5. : GAGCCCTAACTCCAGCTTCCTAAA. : CTCTGTATGAACTAGGTGAAAGGACGTAAAATAGGCCCTTGAATGCGTG. PERV-A (Repbase). S1. S5. S1. S5. S1. : TGAGATAACAGGGAAAAGGGTT.

1 / 1

Download Presentation

Genome Information Lab

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Luc Luc Luc Luc Luc Luc structure U3 R U5 : GAGCCCTAACTCCAGCTTCCTAAA : CTCTGTATGAACTAGGTGAAAGGACGTAAAATAGGCCCTTGAATGCGTG PERV-A (Repbase) S1 S5 S1 S5 S1 : TGAGATAACAGGGAAAAGGGTT 1 73 74 109 110 246 343 373 402 484 PERV-B (Repbase) S1 S5 S1 S5 S1 : TATTTTAAAATGATTGGT (Original 18bp repeat) S1 1 73 74 109 110 246 343 373 402 481 : TGTTTTAAAATGATTGGT (Subtype of 18bp repeat) S2 PERV-A5 S1 S5 S1 : TGTTTTAAAACGATTGGT (Subtype of 18bp repeat) 1 52 53 139 140 175 176 312 370 406 429 508 S3 Group1 : TTAAAATTAATTGGT (Subtype of 18bp repeat) PERV-A6 S7 S5 S2 S5 S2 S5 S2 S5 S2 S5 S2 S4 1 52 77 162 163 198 199 335 550 580 609 688 : CCACGGAGCGCGGGCTCTCGA (Original 21bp repeat) S5 PERV-A7 (KYP, KDP, KWP) : CCACGGAGCGCA (Subtype of 21bp repeat) S7 S6 S1 S5 S2 S6 1 52 77 163 214 249 250 385 473 503 532 612 : TGTAGGAAAAATGATTGGT (Subtype of 18bp repeat) S7 PERV-A8 (KYP, KDP, KWP) S7 S5 S2 : AGTTTTGAATTGACTGGTTTGTGA (24bp, C type) : ATAAAA (TATA signal) S8 1 52 77 162 163 198 199 335 395 425 454 533 : TTGTAAAAGCGCGGGCTTG (19bp, C type) : cap site PERV-A5 S9 S1 S5 S1 S5 S1 (KYP, KDP, KWP) 1 52 53 139 140 175 176 312 409 439 468 547 Group1a PERV-A6 (KWP1) S7 S5 S2 S5 S2 S5 S2 S5 S2 S5 S2 S5 S2 S5 S2 1 52 77 162 163 198 199 335 628 658 687 766 PERV-A6 (KWP2) S7 S5 S3 S5 S3 S5 S3 S5 S3 S5 S3 S5 S3 S5 S2 S5 S2 1 52 77 162 163 198 199 335 667 697 726 805 PERV-X9 (KYP, KDP, KWP) S4 S5 S8 S1 S9 Group2 1 52 53 90 91 131 132 215 218 253 254 402 481 501 512 541 620 PERV-X10 S4 S5 S8 S1 S9 1 52 53 90 91 131 132 215 239 274 275 423 502 522 533 562 641 Deleted region: GCCAGTAA Tandem repeated region 339 468 Mouse LTR-IS (Repbase) Conserved region promoter activity (A) HCT116 (B) Cos7 Relative Luciferase Activity (Fold of pGL-2 control) Relative Luciferase Activity (Fold of pGL-2 control) 300 600 900 1200 1500 1800 2100 2400 10 12 14 16 18 20 22 24 0 2 4 6 8 26 0 Vector Only Vector Only KDP KDP PERV-A5 PERV-A5 KYP KYP KWP KWP KWP-1 KWP-1 PERV-A6 PERV-A6 KWP-2 KWP-2 KDP KDP PERV-A7 PERV-A7 KYP KYP KWP KWP KDP KDP PERV-A8 PERV-A8 YKP YKP KWP KWP KYP KYP PERV-X9 PERV-X9 KDP deletion mutants Relative Luciferase Activity (Fold of pGL-2 control) +1 0 2 4 6 8 0 2 4 6 8 10 12 14 16 18 10 12 14 Vector Only None 1 2 3456 7 8 9 10 1112 13 14 +1 Full +1 Del 1-157 +1 Del 1-207 +1 Del 1-389 +1 Del 1-480 HCT116 Cos7 Muscle initiator sequence-20 1. 5. 9. 13. MEF-2 AhR E2F 2. 6. 10. PPAR v-ErbA NF-Y 3. 7. 11. 14. HFH-3 Oct-1 C-Myb Oct-1 4. 8. 12. AREB6 SMAD-3 Gfi methylation Identification and characterization of PERV LTR elements in various Korean pig genomes Identification and characterization of PERV LTR elements in various Korean pig genomes Hong-Seok Ha1, Jae-Won Huh1, Dae-Soo Kim2, Yun-Ji Kim1, Ja-Rang Lee1, Kung Ahn1, Byung-Wook Cho3, and Heui-Soo Kim1,2 1 Division of Biological Sciences, College of Natural Sciences, Pusan National University, Busan 609-735, Republic of Korea 2 PBBRC, Interdisciplinary Research Program of Bioinformatics, College of Natural Sciences, Pusan National University, Busan 609-735, Republic of Korea 3 Department of Animal Science, College of Life Sciences, Pusan National University, Miryang 627-706, Republic of Korea HTTP://WWW.PRIMATE.OR.KR ABSTRACT RESULTS & DISCUSSION Porcine endogenous retroviruses (PERVs) represent a potential infectious risk in the pig-to-human transplantation. Solitary long terminal repeat (LTR) elements of the PERV specifically affect the replication properties of single viruses and adjacent genes. Using PCR, sequencing, and bioinformatic approach, 12 members of solitary PERV LTR elements in various loci were identified and analyzed in various Korean pigs. The promoter activity of solitary LTR elements belonging to the PERV-A and –B families in Korean pigs using a luciferase assay were examined. Potential negative and positive factors for the PERV transcription regulation are identified from the deletion mutant analysis. The solitary PERV LTR element recently integrated into the haploid genome showed less promoter activity than the older in diploid genome of pigs. Methylation analyses of those solitary LTR elements indicated that the ‘young’ solitary LTR element was hypomethylated, whereas the ‘old’ solitary LTR elements were hypermethylated in most tissues examined. Our data suggest that the LTR elements having high promoter activity are hypermethylated to protect their biological activity in various tissues of pigs. INTRODUCTION GAG POL ENV GAG POL ENV 1. Pig transplant donor with infectious endogenous provirus (PERV) 2. “Donation” of organ to human recopient 3. Production of PERV, infection of nearby host cells 4. Systemic spread Adaptiation of virus to human host 5. Induction of disease 6. Epidemic spread MATERIALS & METHODS Molecular cloning and sequencing of PERV LTR elements Template DNA 94℃ Denature 55℃ X 30 Anneal Primer 72℃ DNA polymerase Extension Cell culture and transient transfection assay REFERENCES Methylation analysis • Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang W, Miller W, Lipman DJ (1997) Gapped Blast and PSI-BLAST: a new generation of protein database search program. Nucleic Acids Res 25: 3389-3402. • Akiyoshi DE, Denaro M, Zhu S, Greenstein JL, Banerjee P, Fishman JA (1998) Identification of a full-length cDNA for an endogenous retrovirus of miniature swine. J Virol 72: 4503-4507. • 3. Denner J, Specke V, Thiesen U, Karlas A, Kurth R (2003) Genetic alteration of the long terminal repeat of an ecotropic porcine endogenous retrovirus during passage in human cells. Virology 314: 125-133. HhaI 5’-GCGC-3’ 3’-CGCG-5’ Genome Information Lab

More Related