lalo
Uploaded by
6 SLIDES
258 VIEWS
60LIKES

DNA

DESCRIPTION

Cracking the Code. DNA. VC: Cracking the code. copied and read. RNA. translated. http://entomology.wisc.edu/~goodman/wgr...rch.html. PROTEIN. DNA COPIES ITSELF : Base pairings: A- T C – G DNA molecule unzips breaking the base pairs forming 2 sides. VC: DNA Replication

1 / 6

Download Presentation

DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Cracking the Code DNA VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN

  2. DNA COPIES ITSELF:Base pairings: A- T C – GDNA moleculeunzips breaking the base pairs forming 2 sides VC: DNA Replication VC: How DNA copies itself

  3. A: TACCGGATGCCAGATCAAATCWhat is the other side? Given the code of a DNA molecule, what would be the code of the new DNA strand? ATGGCCTACGGTCTAGTTTAG B: TACGGGGGCGTAACCACAACTWhat is the other side? ______________________________

  4. 2.CODE IS READ into RNA. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U to make RNA. From #1: (DNA copy) ATGGCCTACGGTCTAGT T TAG AUGGCCUACGGUCUAGUUUAG A: ____________________________________ ATGCCCCCGCATTGGTGTTGA B: ____________________________________

  5. 3. RNA CODE IS TRANSLATED into PROTEINS (amino acids). RNA is small enough to leave the nucleus and go into cytoplasm= messenger. The RNA message is grouped into codons. (codon = 3 RNA nucleotide bases) AUG/GCC/UAC/GGU/CUA/GUU/UAG A: ____________________________________

  6. Step 3 continued. Codons are translated into PROTEINS (Amino Acid) sequence AUG/ GCC/ UAC/ GGU/ CUA/ GUU/ UAG A: Methionine-Alanine-Tyrosine-Glycine- Leucine-Valine-Stop B: AUG CCC CCG CAU UGG UGU UGA

More Related