lali
Uploaded by
44 SLIDES
658 VIEWS
440LIKES

The PAQ4 Data Compressor

DESCRIPTION

The PAQ4 Data Compressor. Matt Mahoney Florida Tech. Outline. Data compression background The PAQ4 compressor Modeling NASA valve data History of PAQ4 development. Data Compression Background. Lossy vs. lossless Theoretical limits on lossless compression Difficulty of modeling data

1 / 44

Download Presentation

The PAQ4 Data Compressor

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. The PAQ4 Data Compressor Matt Mahoney Florida Tech.

  2. Outline • Data compression background • The PAQ4 compressor • Modeling NASA valve data • History of PAQ4 development

  3. Data Compression Background • Lossy vs. lossless • Theoretical limits on lossless compression • Difficulty of modeling data • Current compression algorithms

  4. Lossy vs. Lossless • Lossy compression discards unimportant information • NTSC (color TV), JPEG, MPEG discard imperceptible image details • MP3 discards inaudible details • Losslessly compressed data can be restored exactly

  5. Theoretical Limits on Lossless Compression • Cannot compress random data • Cannot compress recursively • Cannot compress every possible message • Every compression algorithm must expand some messages by at least 1 bit • Cannot compress x better than log2 1/P(x) bits on average (Shannon, 1949)

  6. Difficulty of Modeling • In general, the probability distribution P of a source is unknown • Estimating P is called modeling • Modeling is hard • Text: as hard as AI • Encrypted data: as hard as cryptanalysis

  7. Text compression is as hard as passing the Turing test for AI • P(x) = probability of a human dialogue x (known implicitly by humans) • A machine knowing P(A|Q) = P(QA)/P(Q) would be indistinguishable from human • Entropy of English ≈ 1 bit per character (Shannon, 1950) • Best compression: 1.2 to 2 bpc (depending on input size) Q: Are you human? A: Yes Computer

  8. Compressing encrypted data is equivalent to breaking the encryption • Example: x = 1,000,000 0 bytes encrypted with AES in CBC mode and key “foobar” • The encrypted data passes all tests for statistical randomness (not compressible) • C(x) = 65 bytes using English • Finding C(x) requires guessing the key

  9. Nevertheless, some common data is compressible

  10. Redundancy in English text • Letter frequency: P(e) > P(q) • so “e” is assigned a shorter code • Word frequency: P(the) > P(eth) • Semantic constraints: P(drink tea) > P(drink air) • Syntactic constraints: P(of the) > P(the of)

  11. Redundancy in images (pic from Calgary corpus) Adjacent pixels are often the same color, P(000111) > P(011010)

  12. Redundancy in the Calgary corpusDistance back to last match of length 1, 2, 4, or 8

  13. Redundancy in DNA tcgggtcaataaaattattaaagccgcgttttaacaccaccgggcgtttctgccagtgacgttcaagaaaatcgggccattaagagtgagttggtattccatgttaagcatccacaggctggtatctgcaaccgattataacggatgcttaacgtaatcgtgaagtatgggcatatttattcatctttcggcgcagaatgctggcgaccaaaaatcacctccatccgcgcaccgcccgcatgctctctccggcgacgattttaccctcatattgctcggtgatttcgcgggctacc P(a)=P(t)=P(c)=P(g)=1/4 (2 bpc) e.coli (1.92 bpc?)

  14. Some data compression methods • LZ77 (gzip) – Repeated strings replaced with pointers back to previous occurrence • LZW (compress, gif) – Repeated strings replaced with index into dictionary • LZ decompression is very fast • PPM (prediction by partial match) – characters are arithmetic encoded based on statistics of longest matching context • Slower, but better compression

  15. LZ77 Example the cat in the hat Sub-optimal compression due to redundancy in LZ77 coding or? ...a...a...a...

  16. LZW Example at the in the cat in the hat a ab b bc c Sub-optimal compression due to parsing ambiguity ab+c or a+bc? ...ab...bc...abc...

  17. Predictive Arithmetic Compression (optimal) Compressor input p Predict next symbol Arithmetic Coder compressed data Decompressor output Predict next symbol p Arithmetic Decoder

  18. Arithmetic Coding • Maps string x into C(x)  [0,1) represented as a high precision binary fraction • P(y < x) < C(x) < P(y ≤ x) • < is a lexicographical ordering • There exists a C(x) with at most a log2 1/P(x) + 1 bit representation • Optimal within 1 bit of Shannon limit • Can be computed incrementally • As characters of x are read, the bounds tighten • As the bounds tighten, the high order bits of C(x) can be output

  19. Arithmetic coding example • P(a) = 2/3, P(b) = 1/3 • We can output “1” after the first “b” aaa = “” 0 a aa aaa 0.01 aab aba = 1 ab aba 0.1 abb b ba baa baa = 11 0.11 bab bb bba bbb = 11111 bbb

  20. Prediction by Partial Match (PPM) Guess next letter by matching longest context the cat in th? Longest context match is “th” Next letter in context “th” is “e” the cat in the ha? Longest context match is “a” Next letter in context “a” is “t”

  21. How do you mix old and new evidence? ..abx...abx...abx...aby...ab? P(x) = ? P(y) = ?

  22. How do you mix evidence from contexts of different lengths? ..abcx...bcy...cy...abc? P(x) = ? P(y) = ? P(z) = ? (unseen but not impossible)

  23. PAQ4 Overview • Predictive arithmetic coder • Predicts 1 bit at a time • 19 models make independent predictions • Most models favor newer data • Weighted average of model predictions • Weights adapted by gradient descent • SSE adjusts final probability (Osnach) • Mixer and SSE are context sensitive

  24. PAQ4 Input Data context Model p Mixer Model Arithmetic Coder p p SSE Model Model Compressed Data

  25. 19 Models • Fixed (P(1) = ½) • n-gram, n = 1 to 8 bytes • Match model for n > 8 • 1-word context (white space boundary) • Sparse 2-byte contexts (skips a byte) (Osnach) • Table models (2 above, or 1 above and left) • 8 predictions per byte • Context normally begins on a byte boundary

  26. n-gram and sparse contexts .......x? .....x.x? ......xx? ....x..x? .....xxx? ....x.x.? ....xxxx? x...x...? ...xxxxx? .....xx.? ..xxxxxx? ....xx..? .xxxxxxx? ... word? (begins after space) xxxxxxxx? xxxxxxxxxx? (variable length > 8)

  27. Record (or Table) Model • Find a byte repeated 4 times with same interval, e.g. ..x..x..x..x • If interval is at least 3, assume a table • 2 models: • first and second bytes above • bytes above and left ...x... ...x... ...? ....... ...x... ..x?

  28. Nonstationary counter model • Count 0 and 1 bits observed in each context • Discard from the opposite count: • If more than 2 then discard ½ of the excess • Favors newer data and highly predictive contexts

  29. Nonstationary counter example Input (in some context) n0 n1 p(1) ----------------------- -- -- ---- 0000000000 10 0 0/10 00000000001 6 1 1/7 000000000011 4 2 2/6 0000000000111 3 3 3/6 00000000001111 2 4 4/6 000000000011111 2 5 5/7 0000000000111111 2 6 6/8

  30. Mixer • p(1) = i win1i / i ni • wi = weight of i’th model • n0i, n1i = 0 and 1 counts for i’th model • ni = n0i + n1i • Cost to code a 0 bit = -log p(1) • Weight gradient to reduce cost = ∂cost/∂wi = n1i/jwjnj – ni/jwjn1j • Adjust wi by small amount (0.1-0.5%) in direction of negative gradient after coding each bit (to reduce the cost of coding that bit)

  31. Secondary Symbol Estimation (SSE) • Maps P(x) to P(x) • Refines final probability by adapting to observed bits • Piecewise linear approximation • 32 segments (shorter near 0 or 1) • Counts n0, n1 at segment intersections (stationary, no discounting opposite count) • 8-bit counts are halved if over 255

  32. SSE example Output p 1 Initial function Trained function 0 0 Input p 1

  33. Mixer and SSE are context sensitive • 8 mixers selected by 3 high order bits of last whole byte • 1024 SSE functions selected by current partial byte and 2 high order bits of last whole byte

  34. Experimental Results on Popular Compressors, Calgary Corpus

  35. Results on Top Compressors

  36. Compression for Anomaly Detection • Anomaly detection: finding unlikely events • Depends on ability to estimate probability • So does compression

  37. Prior work • Compression detects anomalies in NASA TEK valve data • C(normal) = C(abnormal) • C(normal + normal) < C(normal + abnormal) • Verified with gzip, rk, and paq4

  38. NASA Valve Solenoid Traces • Data set 3 solenoid current (Hall effect sensor) • 218 normal traces • 20,000 samples per trace • Measurements quantized to 208 values • Data converted to a 4,360,000 byte file with 1 sample per byte

  39. Graph of 218 overlapped traces data (green)

  40. Compression Results

  41. PAQ4 Analysis • Removing SSE had little effect • Removing all models except n=1 to 5 had little effect • Delta coding made compression worse for all compressors • Model is still too large to code in SCL, but uncompressed data is probably noise which can be modeled statistically

  42. Future Work • Compress with noise filtered out • Verify anomaly detection by temperature, voltage, and plunger impediment (voltage test 1) • Investigate analog and other models • Convert models to rules

  43. History of PAQ4

  44. Acknowledgments • Serge Osnach (author of EPM) for adding SSE and sparse models to PAQ2, PAQ3N • Yoockin Vadim (YBS), Werner Bergmans, Berto Destasio for benchmarking PAQ4 • Jason Schmidt, Eugene Shelwien (ASH, PPMY) for compiling faster/smaller executables • Eugene Shelwien, Dmitry Shkarin (DURILCA, PPMONSTR, BMF) for improvements to SSE contexts • Alexander Ratushnyak (ERI) for finding a bug in an earlier version of PAQ4

More Related