1 / 84

3 hoofdonderdelen 1) Cel, DNA, genen, transcriptie, translatie

3 hoofdonderdelen 1) Cel, DNA, genen, transcriptie, translatie 2) the genome, genes, differences between people 3) genome browsers (brugje naar onderdeel Martin). Life, Cells, Proteins. The study of life  the study of cells Cells are born, do their job, duplicate, die

kylan-gaines
Download Presentation

3 hoofdonderdelen 1) Cel, DNA, genen, transcriptie, translatie

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. 3 hoofdonderdelen • 1) Cel, DNA, genen, transcriptie, translatie • 2) the genome, genes, differences between people • 3) genome browsers(brugje naar onderdeel Martin)

  2. Life, Cells, Proteins • The study of life  the study of cells • Cells are born, do their job, duplicate, die • All these processes controlled by proteins

  3. Molecular Biology Background • Cells – general structure/organization • Molecules – that make up cells • Cellular processes – what makes the cell alive

  4. Cells • The cell is the fundamental working unit of every living organism. • Humans: trillions of cells (metazoa); other organisms like yeast: one cell (protozoa). • Different types of cell: • Skin, brain, red/white blood • Different biological function • Cells produced by cells • Cell division (mitosis) • 2 daughter cells • Eukaryotic cells • Have a nucleus

  5. Two Cell Organizations • Prokaryotes – lack nucleus, simpler internal structure, generally quite smaller • Eukaryotes – with nucleus (containing DNA) and various organelles

  6. Selected organelles… • Nucleus – contains chromosomes/DNA • Mitochondria – generate energy for the cell, contains mitochrondrial DNA • Ribosomes – where translation from mRNA to proteins take place (protein synthesis machinery) • Lysosomes – where protein degradation takes place

  7. Cells can become specialized…

  8. Three domains of life • Prokarya Bacteria Archaea • Eukarya Eukaryotes

  9. Universal phylogenetic tree. Fig. 1 from: N.R. Pace, Science276 (1997) 734-740.

  10. Nucleus and Chromosomes • Each cell has nucleus • Rod-shaped particles inside • Are chromosomes • Which we think of in pairs • Different number for species • Human(46),tobacco(48) • Goldfish(94),chimp(48) • Usually paired up • X & Y Chromosomes • Humans: Male(xy), Female(xx) • Birds: Male(xx), Female(xy)

  11. Chromosomes and DNA

  12. DNA • DNA is a molecule: deoxyribonucleic acid • Double helical structure (discovered by Watson, Crick & Franklin) • Chromosomes are densely coiled and packed DNA

  13. Chromosome DNA SOURCE: http://www.microbe.org/espanol/news/human_genome.asp

  14. DNA Strands • Chromosomes are same in every cell of organism • Supercoiled DNA (Deoxyribonucleic acid) • Take a human, take one cell • Determine the structure of all chromosonal DNA • You’ve just read the human genome (for 1 person) • Human genome project • 13 years, 3.2 billion chemicals (bases) in human genome • Other genomes being/been decoded: • Pufferfish, fruit fly, mouse, chicken, yeast, bacteria

  15. DNA • A deoxyribonucleic acid or DNA molecule is a double-stranded polymer composed of four basic molecular units called nucleotides. • Each nucleotide comprises a phosphate group, a deoxyribose sugar, and one of four nitrogen bases: adenine (A), guanine (G), cytosine (C), and thymine (T). • The two chains are held together by hydrogen bonds between nitrogen bases. • Base-pairing occurs according to the following rule: G pairs with C, and A pairs with T.

  16. Genes • The human genome is distributed along 23 pairs of chromosomes. • 22 autosomal pairs; • the sex chromosome pair, XX for females and XY for males. • In each pair, one chromosome is paternally inherited, the other maternally inherited. • Chromosomes are made of compressed and entwined DNA. • A (protein-coding) gene is a segment of chromosomal DNA that directs the synthesis of a protein.

  17. Central dogma • The expression of the genetic information stored in the DNA molecule occurs in two stages: (i) transcription, during which DNA is transcribed into mRNA; (ii) translation, during which mRNA is translated to produce a protein. DNA  mRNA  protein • Other important aspects of regulation: methylation, alternative splicing, etc. • The correspondence between DNA's four-letter alphabet and a protein's twenty-letter alphabet is specified by the genetic code, which relates nucleotide triplets to amino acids.

  18. Genetic and physical maps

  19. DNA under electron microscope

  20. 3D model of a section of the DNA molecule

  21. Genetic code

  22. Replication of DNA

  23. Transcription • Process of making a single stranded mRNA using double stranded DNA as template • Only genes are transcribed, not all DNA • Gene has a transcription “start site” and a transcription “stop site”

  24. Ik wil er ook iets in dat de genen in beide richtingen op het DNA kunnen liggen, • Over coding strand, template strand etc etc. OPZOEKEN!! • Dit komt ook terug in oefeningen.

  25. Gene structure • Exons and Introns • Introns are “spliced” out, and are not part of mRNA • Promoter (upstream) of gene

  26. Gene expression • Process of making a protein from a gene as template • Transcription, then translation • Can be regulated

  27. Gene Regulation • Chromosomal activation/deactivation • Transcriptional regulation • Splicing regulation • mRNA degradation • mRNA transport regulation • Control of translation initiation • Post-translational modification

  28. GENE ACAGTGA PROTEIN Transcriptional regulation TRANSCRIPTION FACTOR

  29. GENE ACAGTGA PROTEIN Transcriptional regulation TRANSCRIPTION FACTOR

  30. READING FRAMES The DNA is translated per codon = nucleotide-triplet. The sequence: …ACGTACGTACGTACGTACGT… Can thus be read as: …-ACG-TAC-GTA-CGT-ACG-TAC-GT… or: …A-CGT-ACG-TAC-GTA-CGT-ACG-T… or: …AC-GTA-CGT-ACG-TAC-GTA-CGT-… Introduction to BioinformaticsLECTURE 2: Section 2.3 Gene annotation: gene finding

  31. OPEN READING FRAMES: ORF • An open reading frame or ORF is a portion of an organism's genome which contains a sequence of bases that could potentially encode a protein • In a gene, ORFs are located between the start-code sequence (initiation codon) and the stop-code sequence (termination codon). Introduction to BioinformaticsLECTURE 2: Section 2.3 Gene annotation: gene finding

  32. OPEN READING FRAMES: ORF Introduction to BioinformaticsLECTURE 2: Section 2.3 Gene annotation: gene finding

  33. Genetic code: exons/introns

  34. intron - exon Introduction to BioinformaticsLECTURE 2: GENE FINDING

  35. Translation • Process of making an amino acid sequence from (single stranded) mRNA • Each triplet of bases translates into one amino acid • Each such triplet is called “codon” • The translation is basically a table lookup

  36. Genetic code: TRANSLATION RNA → protein

  37. The Genetic Code SOURCE: http://www.bioscience.org/atlases/genecode/genecode.htm

  38. Differences in DNA • DNA differentiates: • Species/race/gender • Individuals • We share DNA with • Primates,mammals • Fish, plants, bacteria • Genotype • DNA of an individual • Genetic constitution • Phenotype • Characteristics of the resulting organism • Nature and nurture tiny 2% Share Material Roughly 4%

  39. Evolution of Genes: Inheritance • Evolution of species • Caused by reproduction and survival of the fittest • But actually, it is the genotype which evolves • Organism has to live with it (or die before reproduction) • Three mechanisms: inheritance, mutation and crossover • Inheritance: properties from parents • Embryo has cells with 23 pairs of chromosomes • Each pair: 1 chromosome from father, 1 from mother • Most important factor in offspring’s genetic makeup

  40. Evolution of Genes: Mutation • Genes alter (slightly) during reproduction • Caused by errors, from radiation, from toxicity • 3 possibilities: deletion, insertion, alteration • Deletion: ACGTTGACTC  ACGTGACTC • Insertion: ACGTTGACTC  AGCGTTGACTC • Substitution: ACGTTGACTC  ACGATGACTT • Mutations are almost always deleterious • A single change has a massive effect on translation • Causes a different protein conformation

  41. Evolution of Genes: Crossover (Recombination) • DNA sections are swapped • From male and female genetic input to offspring DNA

  42. Histone modification DNase I sensitive site Conserved sequence Gene SNP The Genome

  43. Genome • The entire sequence of DNA in a cell • All cells have the same genome • All cells came from repeated duplications starting from initial cell (zygote) • Human genome is 99.9% identical among individuals • Human genome is 3 billion base-pairs (bp) long

  44. Genome features • Genes • Regulatory sequences • The above two make up 5%of human genome • What’s the rest doing? • We don’t know for sure • “Annotating” the genome • Task of bioinformatics

More Related