by brett kratchman n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
By: Brett Kratchman PowerPoint Presentation
Download Presentation
By: Brett Kratchman

Loading in 2 Seconds...

play fullscreen
1 / 16

By: Brett Kratchman - PowerPoint PPT Presentation


  • 124 Views
  • Uploaded on

Red\Green Colorblindness. By: Brett Kratchman. Introduction to Colorblindness.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'By: Brett Kratchman' - kimimela


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
by brett kratchman

Red\Green Colorblindness

By: Brett Kratchman

slide2

Introduction to Colorblindness

Colorblindness is a defect of vision affecting the ability to distinguish colors, occurring mostly in males. Color blindness is caused by a defect in the retina or in other nerve portions of the eye. Also known as dichromatism, this disease consists of the inability to differentiate between reds and greens.

slide3

Signs and Symptoms

The signs and symptoms of colorblindness depend on certain factors:

  • Is the problem congenital, acquired, partial, or complete?
  • Does the patient have trouble distinguishing reds and greens?
  • Is the patient experiencing reduced vision?
slide4

Detecting Colorblindness

Color vision deficiency is usually detected using colored charts called the Ishihara Test Plates. The plates consist of gray and colored dots. The patient is asked to identify the number in the middle of the circle. After the patient has identified what they see, more testing may commence.

Vision test examples.Normal people should see 74. Color deficient people may see D=21.

slide5

How are Tests Made?

  • A random pattern of gray level dots is first put together.
  • A digit pattern is then added which is defined by yellow/blue variation only. Since most people with red/green colorblindness can see yellow/blue they will be able to see the digit 5 in this test pattern.
  • Another digit pattern which is defined by red/green variation is added. Here is the pattern composed of the random brightness pattern and the red/green pattern.
  • Finally all three are added: People with red/green deficiency will not be able to see the red/green pattern and will see the 5. People with normal vision will see both the patterns, but since the red/green is stronger than the yellow/blue, the normal person will see the digit 6.
slide6

What's it Like Being Colorblind?

Most color-blind people see normally in all other aspects other than the color of their weakened cone. Color-blind people can usually learn by experience to associate certain colors with different sensations of brightness. Many victims of the defect are unaware that they are color-blind.

Weak green cone

Weak red cone

slide7

Green Color Blindness

GENE LOCATION

Gene OPN1MW GC0XP148439

  • Start:148,439,714 bp from pter
  • End:148,453,078 bp from pter
  • Size:13,364 bases
  • Orientation:plus strand

(and information)

slide8

Red Color Blindness

GENE LOCATION

Gene OPN1LW GC0XP147547

  • Start:147,547,307 bp from pter
  • End:147,561,950 bp from pter
  • Size:14,643 bases
  • Orientation:plus strand

(and information)

slide9

>ENST00000276348ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAGGACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTCGAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATGATCTTTGTGGTCATTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTGGCAGAGACCGTCATCGCCAGCACTATCAGCGTTGTGAACCAGGTCTATGGCTACTTCGTGCTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGTCTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCTGCAAGCCCTTTGGCAATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGGCTGCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAGACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATGATTGTCCTCATGGTCACCTGCTGCATCACCCCACTCAGCATCATCGTGCTCTGCTACCTCCAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAGAAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGCTGGGGACCATACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGCTACCCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTTCTTTGCCAAAAGTGCCACTATCTACAACCCCGTTATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAGGTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCGGTATCGCCTGCATGA>ENST00000276348ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAGGACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTCGAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATGATCTTTGTGGTCATTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTGGCAGAGACCGTCATCGCCAGCACTATCAGCGTTGTGAACCAGGTCTATGGCTACTTCGTGCTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGTCTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCTGCAAGCCCTTTGGCAATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGGCTGCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAGACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATGATTGTCCTCATGGTCACCTGCTGCATCACCCCACTCAGCATCATCGTGCTCTGCTACCTCCAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAGAAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGCTGGGGACCATACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGCTACCCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTTCTTTGCCAAAAGTGCCACTATCTACAACCCCGTTATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAGGTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCGGTATCGCCTGCATGA

Gene Sequence

slide10

>ENST00000218195ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAGGACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTCGAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATGATCTTTGTGGTCACTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTAGCAGAGACCGTCATCGCCAGCACTATCAGCATTGTGAACCAGGTCTCTGGCTACTTCGTGCTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGTCTCTGGTCTCTGGCCATCATTTCCTGGGAGAGGTGGCTGGTGGTGTGCAAGCCCTTTGGCAATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGTCTGCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAGACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATGATTGTCCTCATGGTCACCTGCTGCATCATCCCACTCGCTATCATCATGCTCTGCTACCTCCAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAGAAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGATCTTTGCGTACTGCGTCTGCTGGGGACCCTACACCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGTTACGCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTACTTTGCCAAAAGTGCCACTATCTACAACCCCGTTATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAGGTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCGGTATCGCCTGCATGA>ENST00000218195ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAGGACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTCGAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATGATCTTTGTGGTCACTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTAGCAGAGACCGTCATCGCCAGCACTATCAGCATTGTGAACCAGGTCTCTGGCTACTTCGTGCTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGTCTCTGGTCTCTGGCCATCATTTCCTGGGAGAGGTGGCTGGTGGTGTGCAAGCCCTTTGGCAATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGTCTGCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAGACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATGATTGTCCTCATGGTCACCTGCTGCATCATCCCACTCGCTATCATCATGCTCTGCTACCTCCAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAGAAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGATCTTTGCGTACTGCGTCTGCTGGGGACCCTACACCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGTTACGCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTACTTTGCCAAAAGTGCCACTATCTACAACCCCGTTATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAGGTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCGGTATCGCCTGCATGA

Gene Sequence

slide11

AccessionNumber

Codon

Nucleotide

Amino acid

Phenotype

CM920309

203

aTGC-CGC

Cys-Arg

Trichromacy, deutan

Genetic Mutations

( G r e e n )

Nucleotide substitutions (missense / nonsense)

slide12

AccessionNumber

Codon

Nucleotide

Amino acid

Phenotype

CM951111

203

aTGC-CGC

Cys-Arg

Blue cone monochromatism

Genetic Mutations

( R e d )

Nucleotide substitutions (missense / nonsense)

slide13

What's Being Done Now?

ColorMax has recently introduced a tinted lens for glasses. ColorMax lenses are designed to improve the vision of specific colors that look the same to people with red green color deficiencies. However, the vision of other colors has actually been impaired. Other than these lenses, there isn’t much that can be done to cure color blindness, thus making research obsolete.

slide14

Protein Affected

Rhodospin, the receptor protein in rod cells, crosses the disc membrane seven times. Its odd shape is shared by three receptor proteins in cone cells. Retinal (which absobs light) is shown in purple. The other balls (yellow) represent amino acids which make up the rhodospin structure.

slide15

What Can be Done??

Unfortunately, there is nothing that can be done once diagnosed with color blindness. Color blindness is a life long condition that can exclude people from certain jobs such as a pilot or a job that would include electronics. If you suspect colorblindness, you can visit an ophthalmologist or your health care provider. Being aware of the disease is the best way to help someone overcome this disease.