180 likes | 279 Views
Explore the implementation of computational analysis through web services in bioinformatics. Learn about service registries, ontologies, data transfer, and automation in the BioMoby architecture presented at a BioMed Workshop in 2007.
E N D
Implementing computational analysis through Web services Arnaud Kerhornou CRG/INB Barcelona - BioMed Workshop IRB November 2007
Limits • Discovery • Service description • Ontologies • Data transfert • Automation
BioMoby architecture Service Descriptions A web service is an interface that describes a collection of operations that are network accessible through standardized XML messaging Service registry Find Publish WSDL, UDDI WDSL, UDDI Service Description Service Bind Service Requestor Service Provider
BioMobya unifying framework approach • The bioMoby project aims to provide bioinformatics resources through the web. It can be data retrieval resources or analysis resources. • It defines an ontology-based messaging standard • The services are registered in a central “yellow pages” server to facilitate the discovery • The services specifications are formalized in a description language.
The BioMoby framework It provides: • A Central Registry of services • A set of standards to specify: • Message formatting, • Error reporting • Asynchronous requests • An API written in two languages, perl and java • Ontologies to represent • Types of services, • Data types
Ontology • Data exchange relies on the use of Ontologies. • Ontology to represent knowledge in a given domain • In bioinformatics: • OBO (GO, SO and many many more) • http://obo.sourceforge.net/cgi-bin/table.cgi • Biomoby datatypes to classify service input/output • Biomoby service types
The BioMoby ontologies Establish Ontologies to formalize the representation of: • Types of services • Types of data
The Service TypeOntology SequenceAnalysis GeneFinding Service Bioinformatics PairwiseSequenceAlignment is-a Alignment MultipleSequenceAlignment
The Data TypeOntology has-a String GFF text_formatted text_plain is-a has-a Object AminoAcidSequence is-a VirtualSequence GenericSequence has-a Integer DNASequence
Moby DNASequenceObject <DNASequence> <String articleName=”Sequence”> AAATGTCGCTCGATACGATCAGCTACGA </String> <Integer articleName=”Length”> 28 </Integer> </DNASequence>
BioMobyService specs • Service name: Free Text • Service type: Moby service type ontology • Description: Free text • One or more inputs: Moby data type ontology • One or more outputs: Moby data type ontology • One or more parameters: • name (a string) • value (an ‘primitive’, ie a String or an Integer etc.)
Example RunGeneIDGFF service specifications: • Service type: GeneFinding • Description: ab-initio gene finding software • Input: a DNASequence object • Output: a GFF object • Parameters: • Profile (Default is Human) • Strand (Default is both strands)
Client Side • There are different kind of clients • Some of them allow the creation of workflows Programmatic libraries:
Client Side: Taverna I • Java based graphical integrated workbench • It allows the construction of complex distributed workflows • It can handle different kind of services (Moby and others)
Client Side: Taverna II Processors = Webservices Inputs Outputs
Client Side: Taverna III Moby Web service Configuration
BioMoby on the Web • All the info accessible at the Moby homepage at: • http://www.biomoby.org/ • Taverna Web site • http://www.inab.org/MOWServ • Remora Web interface • http://lipm-bioinfo.toulouse.inra.fr/remora/cgi/remora.cgi • MowServ Web interface • http://www.inab.org/MOWServ/ • Genome Analysis services page • http://genome.imim.es/webservices