80 likes | 225 Views
Macugen (pegaptanib) is an innovative treatment for wet age-related macular degeneration (ARMD). As a pegylated nucleic acid, it acts as an antiangiogenic agent, inhibiting vascular endothelial growth factor (VEGF) overexpression that crowds out vital photoreceptors. Unlike other treatments, Macugen does not reverse existing damage but offers symptom management. Administered via intravitreal injection, it presents minimal discomfort. While options like Avastin and Lucentis are available, Macugen’s unique mechanism makes it a valuable choice in managing this serious condition.
E N D
Macugen (pegaptanib) • Treats wet age-related macular degenration • Pegylated nucleic acid • Antiangiogenic: Stops vascular overgrowth • Other options, but does not reverse • Avastin (colon cancer drug) • Lucentis (can actually restore vision—more common)
Macugen – Macular Deneration • wet Age-Related Macular Degeneration (ARMD) • Overexpression of protein VEGF 165: Vascular Endothelial Growth Factor • → vasculature crowds out photoreceptors
Macugen – Active Ingredient • Aptamer – Anti-VEGF nucleic acid (50 kilodaltons) • (CGGAAUCAGUGAAUGCUUAUACAUCCG) • Binds to VEGF, preventing function (similar to other antiangiogenics; different molecule class)
Macugen – Active Ingredient • ((2'-deoxy-2'-fluoro)C-Gm-Gm-A-A-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)C-Am-Gm-(2'-deoxy-2'-fluoro)U-Gm-Am-Am-(2'-deoxy-2'-fluoro)U-Gm-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)U-Am-(2'-deoxy-2'-fluoro)U-Am-(2'-deoxy-2'-fluoro)C-Am-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)C-Gm-(3'→3')-dT), 5'-ester with α,α'-[4,12-dioxo-6-[[[5-(phosphoonoxy)pentyl]amino]carbonyl]-3,13-dioxa-5,11-diaza-1,15-pentadecanediyl]bis[ω-methoxypoly(oxy-1,2-ethanediyl)], sodium salt.
Macugen – Treatment • Technique: • Local anesthetic and antimicrobial • Intravitreal injection (“slight pressure”, but no pain) • Dose: 0.3 mg (1.6 mg pegylated) • Volume: 90 µL (pre-filled syringe)
Macugen – Side Effects • (varying probability) • Air bubble in eye • Itchiness / Soreness • Eye floaters • Cataracts / blurred vision • Increased intravitreal pressure • Infection • Allergic reaction
Macugen – Formulation • Drug provided as sodium salt • Coated in polyethylene glycol to reduce immune response and size in solution • Inactive ingredients: • , (Counterions for drug/salt) • /(pH adjustment)
Macugen – • Stuff!