10 likes | 122 Views
This study focuses on the TRI gene and its associated pseudogenes located on chromosome 19. We analyze the exon-intron structure and alternative splicing events of TRI, highlighting the distinct variants observed in human, mouse, and rat models. Through sequencing and comparison of exon junctions (particularly in the 3rd and alternative exons), we elucidate functional implications and evolutionary significance. The findings provide important insights into the regulation of TRI and its role in cellular processes, contributing to a broader understanding of gene expression and function across species.
E N D
A TRI (AY497473) E1 E2 E3B E3 E4 E5 E6 E7 E8 E9 3`-UTR Pseudogene on chromosome 19, AC010503 (join 118179..117967, 117642..117467, 116129..116055, 116021..115960) AluSX AluSB AluSX L1PA13 AluSX E2 E3 E3 E4 E4 Ctrl PC-3 LNCaP hPCPs B 300 bp 288 bp TRIB TRI 178 bp TRIB C EC Kinase TM 5`-GAACTTCCAACTGgtaag.....aggccctttttcagTAAAGTCATCACCTGGCCTC-3` EXON 2 INTRON 2 EXON 3B EXON 3 TRIB, alternative exon GAACTTCCAACTACTGgccctttttcagTAAAGTCATCACCTGGCCTC hs TRIB (AJ619019) GAACTCCCAACTACAGgacctttttcagAAAAGCAGTCAGCTGGCCTT mm TRIB (NM_009370) GAACTCCCAACTACAGgacctttttcagAAAAGCAGTCAGCTGGCCTC rn TRIB (NM_012775) GAACTCCCAACTGTTGgtccttttccagGAAAGCCACCATCTGGCCTT ss TRIB (NM_001038639) GAACTCCCAACTACAGgacctttttcagAAAAGCAGTCAGCTGGCCTC cf TRIB (AY455799) E L P T T G P F S V K S S P G L hs TRIB (AJ619019) E L P T T G P F S E K Q S A G L mm TRIB (NM_009370) E L P T T G P F S E K Q S A G L rn TRIB (NM_012775) E L P T V G P F PG K PPS G L ss TRIB (NM_001038639) E L P T T G P F S E K Q S A G L cf TRIB (AY455799) TRI, exon2/3 junction GAACTTCCAACTACTGTAAAGTCATCACCTGGCCTC hs TRI (NM_004612) GAACTCCCAACTACAGAAAAGCAGTCAGCTGGCCTT mm TRI (D25540) GAACTCCCAACTACAGAAAAGCAGTCAGCTGGCCTC rn TRI (S81584) GAACTCCCAACTGTTGGAAAGCCACCATCTGGCCTT ss TRIB (DQ519380) E L P T T V K S S P G L hs TRI (NM_004612) E L P T T E K Q S A G L mm TRI (D25540) E L P T T E K Q S A G L rn TRIB (NM_012775) E L P T VG K PPS G L ss TRIB (DQ519380)