1 / 29

John R. Edwards jre13@columbia Columbia Genome Center July 25th, 2007

Application of New DNA Sequencing Technologies for the Study of Epigenetic Abnormalities in Breast Cancer. John R. Edwards jre13@columbia.edu Columbia Genome Center July 25th, 2007. Sequencing by Synthesis. A new paradigm in genomic sequencing. DNA Polymerase Reaction.

kathysjohnson
Download Presentation

John R. Edwards jre13@columbia Columbia Genome Center July 25th, 2007

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Application of New DNA Sequencing Technologies for the Study of EpigeneticAbnormalities in Breast Cancer John R. Edwards jre13@columbia.edu Columbia Genome Center July 25th, 2007

  2. Sequencing by Synthesis A new paradigm in genomic sequencing

  3. DNA Polymerase Reaction

  4. DNA Polymerase Reaction Modifications

  5. G - Linker - O-Block-3’ ACGCTAGCGATCATGCAGCTGCATCG TGCGATCG Sequencing by Synthesis Primer C T A Template

  6. Structure of the Polymerase-DNA-Nucleotide Complex Pelletier et al. (1994) Science264, 1891-1903

  7. DNA Sequencing by Synthesis (SBS) on a Chip Ju J, Li Z, Edwards JR, Itagaki Y. U.S. Patent (2003) 6,664,079

  8. Molecular Structures of 3’-O-Allyl-dNTP-Allyl-Dye Nucleotide Analogues J. Ju et al. PNAS,2006, 103:19635-40.

  9. Emulsion PCR Based DNA Template Preparation

  10. Methylation Landscape of the Human Genome

  11. CpG Methylation and Transcription Jones and Takai (2001) Science 293:1068-70

  12. CpG Composition of the Human Genome

  13. Fractionation of the Genome

  14. McrBC and RE Digests

  15. Fractionation and Analysis Pipeline

  16. Fractionation Methods Show an Unbiased Coverage of the Genome McrBC = 3073 sequences RE = 2565 sequences

  17. http://epigenomics.cu-genome.org/html/meth_landscape/

  18. Custom Methylation Tracks on the UCSC Genome Browser

  19. Methylation Status of Promoters

  20. Alu Elements are Highly Methylated

  21. Categorical Breakdown of Methylated and Unmethylated Compartments

  22. Methylation Limits the Effective Size of the Genome Small Genome Large Genome

  23. Whole-genome Profiling of Breast Cancer

  24. DNA Methylation in Cancer Genomic Hypomethylation • Genomic instability? • Activation of proto-oncogenes? • Loss of Imprinting? M. Esteller (2005) Annual Review of Pharmacology and Toxicology 45:629-656.

  25. New Tools to Probe DNA Methylation in Breast Cancer • Technology Requirements • Whole genome approach • Must examine state of repetitive elements • Unbiased • Must be useable for primary tumors • Goals • Characterize complete methylation profile of breast cancer • Compare normal/tumor, tumor/tumor, tumor/cell-line • Investigate potential as biomarker • Understand patterns of global hypomethylation and regional hypermethylation

  26. Whole-Genome Methylation Profiling

  27. Acknowledgements Jingyue Ju Timothy Bestor (Genetics and Development) Nicholas Turro (Chemistry) Victoria Haghighi (Psychiatry) Ju Lab James J. Russo Zengmin Li Lanrong Bi Xiaoxu Li Shundi ShiDae H. Kim Qingleng Meng Xiaopeng Bai Bestor Lab Rob Rollins Anne O’Donnell National Human Genome Research Institute/NIH NSF, Packard Foundation

More Related