210 likes | 337 Views
Welcome to the world of two Arabidopsis genes:. At4g14770 and At3g22760. At4g14770 and At3g22760. Presented by: Matt Emmer HC70AL Spring 2006. At4g14770 and At3g22760: Tesmin/TSO1-like CXC Domain Proteins. TSO1
E N D
Welcome to the world of two Arabidopsis genes: At4g14770 and At3g22760 At4g14770 and At3g22760 Presented by: Matt Emmer HC70AL Spring 2006
At4g14770 and At3g22760: Tesmin/TSO1-like CXC Domain Proteins • TSO1 • involved in cellular expansion and cytokinesis, as well as in the development of ovules and microspores • Contains two cysteine-rich regions similar to CXC domains involved in chromosome segregation • Tesmin • a member of the CXC family, and a testis-specific protein
9 Homozygous Mutants Identified in First Line 1 Heterozygous Mutant Were there Mutants in the 1st Line? WT Mut
What were the DNA Concentrations? Plant Concentration Plant Concentration Plant 3 5 ng/μL Plant 15 2 ng/μL Expected Size Plant 4 15 ng/μL Plant 16 4 ng/μL Wild Type 1,624 bp Plant 10 4 ng/μL Plant 18 2 ng/μL T-DNA 1,095 bp Plant 12 1.5 ng/μL Wild Type 0.5 ng/μL Plant 13 4.5 ng/μL Were there Mutants in the 2nd Line? No Mutants
Mutantvs.Wild Type Mutant Wild Type Any Difference? NO
1918 + 1319 = 3237 What’s Upstream of At4g14770? 1918 bp 3237 bp 1319 bp I-proof Pcr Ecori Digest Single EcoRI Site in Upstream Region
Upstream Bioinformatics Primers Eco RI Site
Only a single mismatch in the SP6 sequencing data How accurate was the SP6 and T7 Sequencing Data? Actual Sequence:AAAGTAACGGACATCAGTTTTTTTTTTCTTTTCCCTTTTTTCTCTTTTTTG
What’s Upstream of At3g22760? 2911 bp I-proof Pcr Ecori Digest
Did the T-DNA insert actually knock out At4g14770? • Two Possibilities: • Intron was spliced out • T-DNA was not spliced out, resulting in a longer mRNA strand • Follow up experiment:
Conclusions • 1st Line mutants were attained • No mutant phenotype observed • Evidence to suggest that gene knockout was not successful • Limited information obtained for 2nd line • No mutant plants attained • SALK indicates a T-DNA insert is in 5’ UTR, so gene may not have been knocked out • Future Experiments • Double/Triple Knock Outs to overcome duplication: • At4g14770, At3g22760, At3g22780
The TA’s Mike Gaviño Ria Yagnik Jonathan Russell Acknowledgements Big Shots To Be • Tomokazu Kawashima • Brandon Le • Jessica Luke The Big Shots • Dr. Bob Goldberg • Dr. Anhthu Bui • Dr. Xingjun Wang HC70AL Jordan, Thi, Jennifer, Brian, Jordan, Jason, Daisy, Bekah, and Heather