kalin
Uploaded by
14 SLIDES
665 VIEWS
140LIKES

Bioinformatics BITO-215

DESCRIPTION

Bioinformatics BITO-215 . Ayesha Masrur Khan Spring 2013. Course Outline. Introduction to Bioinformatics Definition of Bioinformatics and Related Fields Earliest Bioinformatics Efforts Objective and Scope of Bioinformatics Kind of Data Used in Bioinformatics Introduction to Databases

1 / 14

Download Presentation

Bioinformatics BITO-215

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. BioinformaticsBITO-215 Ayesha Masrur Khan Spring 2013

  2. Course Outline Introduction to Bioinformatics • Definition of Bioinformatics and Related Fields • Earliest Bioinformatics Efforts • Objective and Scope of Bioinformatics • Kind of Data Used in Bioinformatics • Introduction to Databases • Major Biological Databases Sequence Alignment • Pairwise Sequence Alignment • Database Similarity Searching • Multiple Sequence Alignment • Profiles and Hidden Markov Models • Protein Motifs and Domain prediction Introduction

  3. Course Outline..contd. Gene and Promoter Prediction • Gene Prediction • Methods of Gene Prediction • Gene Prediction tools • Promoter and Regulatory Element Prediction • Promoter and Regulatory Element Prediction Tools Molecular Phylogenetics • Phylogenetic Basics • Phylogenetic Tree Construction Methods and Programs • Phylogenetic Tree Evaluation Structural Bioinformatics • Protein Structure Basics • Protein Structure Visualization Tools • Protein Secondary Structure Prediction • Protein Tertiary Structure Prediction • Protein Structure Prediction Tools • RNA Structure Prediction Methods and Tools Introduction

  4. Course Outline..contd. Genomics and Proteomics • Introduction to Genomics • Tools for Genome Analysis • Genome Mapping, Assembly and Comparison • Functional Genomics • Introduction to Proteomics • Tools for Proteome Analysis • Advanced topics • Molecular dynamics simulation • Computational drug design • Microarray data analysis Introduction

  5. Recommended Books • Introduction to Bioinformatics, by T. K. Attwood and D.J. Parry-Smith (2006) Pearson Education, Ltd. • Introduction to Bioinformatics: A Theoretical and Practical Approach, by Stephen A. Krawetz and David D. Womble. • Essential Bioinformatics, by Jin Xiong(2006) Cambridge University Press. Introduction

  6. Course Assessment Assignment: 10% Quizzes: 10 % Sessional-1: 15 % Sessional-2 (project + presentation): 20% Terminal Exam: 45% Introduction

  7. Central Paradigm of Molecular Biology Introduction

  8. Central Paradigm of Bioinformatics Introduction

  9. What is Bioinformatics? • Information technology applied to the management and analysis of biological data. • It was originally coined in the mid-1980s for the analysis of biological data. • It can include computational manipulation and analysis of biological sequence data, as well as manipulation and analysis of three-dimensional structural data. • What laid the foundation of this revolutionary field? • Protein sequencing and Nucleic acid sequencing in the 60’s and 70’s paved the way for sequence revolution and hence the 80’s saw progress in computer-based technologies to cope with this surge in information Introduction

  10. What is Bioinformatics? • Bioinformatics is conceptualizing biology in terms of molecules (in the sense of physical-chemistry) and then applying “informatics” techniques (derived from disciplines such as applied math, CS, and statistics) to understand and organize the information associated with these molecules, on a large-scale. Introduction

  11. Related fields Systems Biology Proteomics: Study of the entire complement of proteins (proteome) Structural Genomics: Pursuance of protein structures on a genome wide scale. Genomics: Study of genomes of organisms. Systems Biology: Studies the complex systems which exist within and across multiple biological scales Introduction

  12. Raw DNA Sequence atggcaattaaaattggtatcaatggttttggtcgtatcggccgtatcgtattccgtgcagcacaacaccgtgatgacattgaagttgtaggtattaacgacttaatcgacgttgaatacatggcttatatgttgaaatatgattcaactcacggtcgtttcgacggcactgttgaagtgaaagatggtaacttagtggttaatggtaaaactatccgtgtaactgcagaacgtgatccagcaaacttaaactggggtgcaatcggtgttgatatcgctgttgaagcgactggtttattcttaactgatgaaactgctcgtaaacatatcactgcaggcgcaaaaaaagttgtattaactggcccatctaaagatgcaacccctatgttcgttcgtggtgtaaacttcaacgcatacgcaggtcaagatatcgtttctaacgcatcttgtacaacaaactgtttagctcctttagcacgtgttgttcatgaaactttcggtatcaaagatggtttaatgaccactgttcacgcaacgactgcaactcaaaaaactgtggatggtccatcagctaaagactggcgcggcggccgcggtgcatcacaaaacatcattccatcttcaacaggtgcagcgaaagcagtaggtaaagtattacctgcattaaacggtaaattaactggtatggctttccgtgttccaacgccaaacgtatctgttgttgatttaacagttaatcttgaaaaaccagcttcttatgatgcaatcaaacaagcaatcaaagatgcagcggaaggtaaaacgttcaatggcgaattaaaaggcgtattaggttacactgaagatgctgttgtttctactgacttcaacggttgtgctttaacttctgtatttgatgcagacgctggtatcgcattaactgattctttcgttaaattggtatc……………………………………………….…………………………..caaaaatagggttaatatgaatctcgatctccattttgttcatcgtattcaacaacaagccaaaactcgtacaaatatgaccgcacttcgctataaagaacacggcttgtggcgagatatctcttggaaaaactttcaagagcaactcaatcaactttctcgagcattgcttgctcacaatattgacgtacaagataaaatcgccatttttgcccataatatggaacgttgggttgttcatgaaactttcggtatcaaagatggtttaatgaccactgttcacgcaacgactacaatcgttgacattgcgaccttacaaattcgagcaatcacagtgcctatttacgcaaccaatacagcccagcaagcagaatttatcctaaatcacgccgatgtaaaaattctcttcgtcggcgatcaagagcaatacgatcaaacattggaaattgctcatcattgtccaaaattacaaaaaattgtagcaatgaaatccaccattcaattacaacaagatcctctttcttgcacttgg 4 bases: AGCT ~1 K in a gene, ~2 M in genome Introduction

  13. Protein Sequence 20 letter alphabet: ACDEFGHIKLMNPQRSTVWY Strings of ~300 aa in an average protein (in bacteria) 200 K known protein sequences Introduction

  14. Homework: State what amino acid each of the 20 letters stand for Introduction

More Related