jovan
Uploaded by
22 SLIDES
443 VIEWS
230LIKES

Bioinformatics - Gene databases

DESCRIPTION

21 Enero 2010 Dr. Victor Treviño. Bioinformatics - Gene databases. HUGO ( www.genenames.org ) NCBI ( http://www.ncbi.nlm.nih.gov ) EBI – EMBL ( http://www.ebi.ac.uk/ ) EBIMed ( http://www.ebi.ac.uk/Rebholz-srv/ebimed/ ) SwissProt / UniProt http://www.ebi.ac.uk/uniprot/

1 / 22

Download Presentation

Bioinformatics - Gene databases

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. 21 Enero 2010 Dr. Victor Treviño Bioinformatics - Gene databases

  2. HUGO (www.genenames.org) • NCBI (http://www.ncbi.nlm.nih.gov) • EBI– EMBL (http://www.ebi.ac.uk/ ) • EBIMed(http://www.ebi.ac.uk/Rebholz-srv/ebimed/ ) • SwissProt / UniProt • http://www.ebi.ac.uk/uniprot/ • http://www.psc.edu/general/software/packages/swiss/swiss.php • PubGene (http://www.pubgene.org/ ) • GeneCards (http://www.genecards.org/ ) • iHOP (http://www.ihop-net.org/UniPub/iHOP/ ) • Panther (http://www.pantherdb.org/ ) • "Others" Gene Databases(DNA, RNA, Protein)

  3. HUGO – HGNCwww.genenames.org • Human Genome Organization • "OFFICIAL" Gene Names NCBI LINKS

  4. The "richest" information about genes NCBI

  5. NCBI

  6. NCBI – Gene Database • Summary • Species (or specific) • Function • Sequence • CDS • Chr Location • Domains • Interactions • GeneRIFs: Gene References Into Function • Lots of LINKS to all parts of NCBI and Externals

  7. NCBI – Nucleotide / Protein GenBank/GenPept Format

  8. Gene Sequence Formats http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml

  9. Gene Sequence Formats

  10. BLAST - Searching a Gene From Sequence • cgagatgcagatagcagctagagat (at random) • small sequences may identify a gene (dbEST, dbSTS, ePCR)

  11. NCBI - UniGene • Unified Information about A Gene across reported sequences • "set of transcript sequences that appear to come from the same transcription locus (gene or expressed pseudogene), together with information on protein similarities, gene expression, cDNA clone reagents, and genomic location." • VERY IMPORTANT : UniGene ID (Hs. xxxxxx)

  12. On-Line Mendelian Inheritance in Man / Animals Curated "Function" of Genes Good References Strong History / Evidence NCBI – OMIM - OMIA

  13. NCBI – Others… • HomoloGene conserved functions • dbEST snapshot of genes expressed in a given tissue • UniSTS sequence tagged sites, PCR primer pairs, genomic position, genes • SNP  Polymorphisms

  14. Ensembl - automatic annotation of large eukaryotic genomes (Genes ID) UniProt - (Universal Protein Resource) is the world's most comprehensive catalogue of information on proteins CiteXplore (good for literature) EBIMed (Tools, semantic mining) EBIhttp://www.ebi.ac.uk/

  15. Uniprot: http://www.uniprot.org/ • Union of Swiss-Prot, TrEMBL, and PIR • Curated: • Swiss-Prot is manually annotated and reviewed. • Good Summaries • References • Sequence • Features (repeats, disulfid, … , domains) • Examples… • Names and origin · Protein attributes · General annotation (Comments) · Ontologies · Alternative products · Sequence annotation (Features) · Sequences · References · Cross-references · Entry information · Relevant documents SwissProthttp://www.ebi.ac.uk/uniprot/

  16. PubGenehttp://www.pubgene.org/ • Good for gene interactions • References • Association to Gene Onthologies (GO) • TEXT-MINING • REALLY NICE

  17. GeneCardshttp://www.genecards.org/ • Good Summary • Function • Lots of links

  18. iHOPhttp://www.ihop-net.org/UniPub/iHOP/ • "Summary" of information for a protein • Linked • TEXT-MINING • REALLY NICE

  19. Pantherhttp://www.pantherdb.org/ • Rich Information • Curated • Pathways • Functions • Families • Homologous

  20. http://bioinformatics.ca/links_directory/ Bioinformatics Links Directory

  21. No SINGLE sitecontains ALL information • wehaveto use severalsources • BioGPS • CURATED data is valuable • Be cautiouswithpredicted data • Relationwithother genes is more difficultto explore Gene databases - summary

  22. http://biogps.gnf.org/ It is a portal of portals You can add as many portal sites as you want Easy to configure Versatile VERY IMPORTANT! BioGPS

More Related