350 likes | 372 Views
Tapestry Workshop: Mentoring for Connections to Computing Activities. Karen C. Davis Professor, Electrical & Computer Engineering karen.davis@uc.edu. Difference Engine. Jacquard Loom. Online Unplugged Resources. mathmaniaCS.org. CSunplugged.org. ** birthday prediction **.
E N D
Tapestry Workshop: Mentoring for Connections to ComputingActivities Karen C. Davis Professor, Electrical & Computer Engineering karen.davis@uc.edu
Difference Engine Jacquard Loom
Online Unplugged Resources mathmaniaCS.org CSunplugged.org ** birthday prediction **
Graph Traversal [boardgamegeek.com]
Movement Programming Digital Logic Surface Tiling [boardgamegeek.com]
College Success Roborally hit the books go to class design computing systems graduate! make the Dean’s List
Software Specification Pattern Recognition Project Management Sorting Grammar Rules [boardgamegeek.com]
Pattern Recognition Warm-up x x √ √ Is this row a set?
Pattern Recognition Warm-up √ √ √ √ Is this row a set?
Pattern Recognition Warm-up √ √ √ √ let’s try it! Is this column a set?
Bioinformatics Internet Message Routing Land Mobile Radio Communications Scheduling with Graph Coloring Scheduling with Graph Coloring Computer Chip Design Medical Imaging Embedded Computers
Binary Numbers Pipe Layout Design Pattern Recognition Bear-a-Trooper Artificial Intelligence Virtual Fashion Design
Multitasking Wii Debate Wii Debate Pixels and Pellets Vision and Precision
Graph A node F B edge E C D 3 edges are adjacent to D
Graphs Atlanta Fairbanks Boston $900 $400 Eugene $800 $200 $300 Cincinnati $400 $700 Dallas $100 • can be represented in a computer program • can be used to solve complex problems Example: find the cheapest way for a traveler to visit every city
Exhaustive vs. Approximate Searching Searching for all possible solutions takes a long time, even for a computer, when there are lots of nodes We use algorithms that search for a good enough solution but don’t try all possible solutions
Using an Approximate Graph Algorithm for Scheduling A event to be scheduled F B conflict between events E C D
Using the Algorithm to Assign Cell Tower Frequencies let’s try it! • count the adjacent edges • color the one with the highest edge count • color any others (not adjacent) with the same color • pick a new color and repeat steps 2-4 until all nodes are colored
Automated Graph Coloring • graph coloring animation
Computer Science Investigations:CSI CincinnatiArtificial Intelligence
Goal of Artificial Intelligence • Can intelligence be modeled by a machine? • A scientific approach is that the behavior of an intelligent organism can be studied and engineered
CAPTCHA • Completely Automated Public Turing test to tell Computers and Humans Apart • reverse Turing test reCAPTCHA: digitizing books using OCR words it can’t recognize are sent out as CAPTCHA words users help to disambiguate the words and demonstrate that they are human CAPTCHA trademarked by Carnegie Mellon University
analysis of DNA to find genes analysis of RNA to predict structure designing new drug molecules
Recognizing Defects normal DNA defective DNA glutamic acid valine atggtgcacctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctggtggtctacccttggacccagaggttctttgagtcctttggggatctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcatggcaagaaagtgctcggtgcctttagtgatggcc … atggtgcacctgactcctgtggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctggtggtctacccttggacccagaggttctttgagtcctttggggatctgtccactcctgatgctgttagggcaaccctaaggtgaaggctcatggcaagaaagtgctcggtgcctttagtgatggcc …
Computers are good at recognizing patterns … that involve huge quantities of data that are complex and non-intuitive
20Q questions appear here use buttons to provide answers play online: www.20q.net Let’s get hands on with some real AI • play 20Q with a group • agree on one object • agree on group answer to 20Q’s questions • make observations on the worksheet
1. start here facing downward bumping into a wall keeps you in the same spot 2. figure out a sequence of moves to finish here falling into a pit or off the board ends your turn