jared
Uploaded by
66 SLIDES
1240 VIEWS
760LIKES

Biological Sequence Analysis

DESCRIPTION

Biological Sequence Analysis. Lecture 26, Statistics 246 April 27, 2004. Synopsis. Some biological background A progression of models Acknowledgements References. The objects of our study. DNA, RNA and proteins: macromolecules which are unbranched polymers built up from smaller units.

1 / 66

Download Presentation

Biological Sequence Analysis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Biological Sequence Analysis Lecture 26, Statistics 246 April 27, 2004

  2. Synopsis • Some biological background • A progression of models • Acknowledgements • References

  3. The objects of our study • DNA, RNA and proteins: macromolecules which are unbranched polymers built up from smaller units. • DNA: units are the nucleotide residues A, C, G and T • RNA: units are the nucleotide residues A, C, G and U • Proteins: units are the amino acid residues A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y. • To a considerable extent, the chemical properties of DNA, RNA and protein molecules are encoded in the linear sequence of these basic units: their primary structure.

  4. DNA transcription mRNA translation Protein The central dogma CCTGAGCCAACTATTGATGAA CCUGAGCCAACUAUUGAUGAA PEPTIDE

  5. A protein-coding gene

  6. Motifs - Sites - Signals - Domains • For this lecture, I’ll use these terms interchangeably to describe recurring elements of interest to us. • In PROTEINS we have: transmembrane domains, coiled-coil domains, EGF-like domains, signal peptides, phosphorylation sites, antigenic determinants, ... • In DNA / RNA we have: enhancers, promoters, terminators, splicing signals, translation initiation sites, centromeres, ...

  7. Motifs and models • Motifs typically represent regions of structural significance with specific biological function. • Are generalisations from known examples. • The models can be highly specific. • Multiple models can be used to give higher sensitivity & specificity in their detection. • Can sometimes be generated automatically from examples or multiple alignments.

  8. The use of stochastic models for motifs • Can be descriptive, predictive or everything else in between…..almost business as usual. • However, stochastic mechanisms should never be takenliterally, but nevertheless they can be amazingly useful. • Care is always needed: a model or method can breakdown at any time without notice. • Biological confirmation of predictions is almost always necessary.

  9. Transcription initiation in E. coliRNA polymerase-promotor interactions In E. coli transcription is initiated at the promotor , whose sequence is recognised by the Sigma factor of RNA polymerase.

  10. Transcription initiation in E. coli, cont. ..YKFSTYATWWIRQAITR..

  11. Determinism 1: consensus sequences •  Factor Promotor consensus sequence • -35-10 • 70 TTGACA TATAAT • 28 CTAAA CCGATAT • Similarly for 32 ,38and 54. • Consensus sequences have the obvious limitation: there is usually some deviation from them.

  12. The human transcription factor Sp1 has 3 Cys-Cys-His-His zinc finger DNA binding domains

  13. Determinism 2: regular expressions • The characteristicmotif of a Cys-Cys-His-Hiszinc finger DNA binding domain has regular expression • C-X(2,4)-C-X(3)-[LIVMFYWC]-X(8)-H-X(3,5)-H • Here, as in algebra, X is unknown. The 29 a.a. sequence of our example domain 1SP1 is as follows, clearly fitting the model. • 1SP1: KKFACPECPKRFMRSDHLSKHIKTHQNKK

  14. Prosite patterns • An early effort at collecting descriptors for functionally important protein motifs. They do not attempt to describe a complete domain or protein, but simply try to identify the most important residue combinations, such as the catalytic site of an enzyme. They use regular expression syntax, and focus on the most highly conserved residues in a protein family. • http://au.expasy.org

  15. More on Prosite patterns This pattern, which must be in the N-terminal of the sequence (‘<'), means: <A - x - [ST] (2) - x(0,1) - V - {LI} Ala-any- [Ser or Thr]-[Ser or Thr] - (any or none)-Val-(any but Leu, Ile)

  16. http://www.isrec.isb-sib.ch/software/PATFND_form.html c.{2,4}c...[livmfywc]........h.{3,5}h PatternFind output [ISREC-Server] Date: Wed Aug 22 13:00:41 MET 2001 ... gp|AF234161|7188808|01AEB01ABAC4F945 nuclear protein NP94b [Homo sapiens] Occurences: 2 Position : 514 CYICKASCSSQQEFQDHMSEPQH Position : 606 CTVCNRYFKTPRKFVEHVKSQGH ........ Searching with regular expressions

  17. Regular expressions can be limiting • The regular expression syntax is still too rigid to represent many highly divergent protein motifs. • Also, short patterns are sometimes insufficient with today’s large databases. Even requiring perfect matches you might find many false positives. On the other site some real sites might not be perfect matches. • We need to go beyond apparently equally likely alternatives, and ranges for gaps. We deal with the former first, having a distribution at each position.

  18. Cys-Cys-His-His profile: sequence logo form A sequence logo is a scaled position-specific a.a.distribution. Scaling is by a measure of a position’s information content.

  19. A C G T 9 214 63 142 118 8 22 7 26 31 52 13 18 2 29 38 29 5 193 19 124 31 43 216 A C G T Counts from 242 known 70 sites Relative frequencies: fbl 2 1 0 A C G T -38 19 1 12 10 -48 -15 -38 -8 -10 -3 -32 -13 -48 -6 -7 -10 -40 17 -32 8 -9 -6 19 1 2 3 4 5 6 10log2fbl/pb Informativeness:2+Sbpbllog2pbl Weight matrix model (WMM) = Stochastic consensus sequence 0.04 0.88 0.26 0.590.49 0.03 0.09 0.03 0.11 0.13 0.21 0.05 0.07 0.01 0.12 0.16 0.12 0.02 0.80 0.08 0.51 0.13 0.18 0.89

  20. Interpretation of weight matrix entries candidate sequence CTATAATC.... aligned position 123456 Hypotheses: S=site (and independence) R=random (equiprobable, independence) log2 = log2 = (2+log2.09)+...+(2+log2.01) = Generally, score sbl = log fbl/pb l=position, b=base pb=background frequency

  21. -38 19 1 12 10 -48 -15 -38 -8 -10 -3 -32 -13 -48 -6 -7 -10 -40 17 -32 8 -9 -6 19 -38 19 1 12 10 -48 -15 -38 -8 -10 -3 -32 -13 -48 -6 -7 -10 -40 17 -32 8 -9 -6 19 A C G T A C G T A C G T -38 19 1 12 10 -48 -15 -38 -8 -10 -3 -32 -13 -48 -6 -7 -10 -40 17 -32 8 -9 -6 19 Use of the matrix to find sites C T A T A A T C sum Move the matrix along the sequence and score each window. Peaks should occur at the true sites. Of course in general any threshold will have some false positive and false negative rate. -93 +85 -95

  22. Profiles Are a variation of the position specific scoring matrix approach just described. Profiles are calculated slightly differently to reflect amino acid substitutions, and the possibility of gaps, but are used in the same way. In general a profile entry Mla for location l and amino acid a is calculated by Mla = ∑bwlbSab where b ranges over amino acids, wlb is a weight(e.g. the observed frequency of a.a. b in position l) and Sab is the (a,b)-entry of a substitution matrix (e.g. PAM or BLOSUM) calculated as a likelihood ratio. Position specific gap penalties can also be included.

  23. Derivation of a profile for Ig domains

  24. g1 ELVKAGSSVK MSCKATGYTF SSYE....LY WV m3 GLVEPGGSLR LSCSASGFTF SAND....MN WV k2 LPVTPGEPAS ISCRSSQSLL DSGDGNTYLN WY l3 VSVALGQTVR ITCQ.GDSLR GYDAA..... WY Cons A B C D E ... Gap Len 13C 30 -40 150 -50 -60 100 100 14K 4 18 -11 17 17 100 100 15A 53 11 19 12 12 30 30 16S 28 21 28 19 16 100 100 We search with a profile in the same way as we did before. These days profiles of this kind have been largely replaced by Hidden Markov Models for sequence searching and alignment.

  25. Modelling motifs: the next steps • Missing from the weight matrix models of motifs and profiles are good ways of dealing with: • Length distributions for insertions/deletions • Local and non-local association of amino acids • Hidden Markov Models (HMM) help with the first. Dealing with the second remains a hard unsolved problem.

  26. Hidden Markov Models • Processes {(St, Ot), t=1,…}, where Stis the hidden • state and Ot the observation at time t, such that • pr(St | St-1, Ot-1,St-2 , Ot-2 …) = pr(St | St-1) • pr(Ot | St ,St-1, Ot-1,St-2 , Ot-2 …) = pr(Ot | St, St-1) • The basics of HMM were laid bare in a series of beautiful papers by L E Baum and colleagues around 1970, and their formulation has been used almost unchanged to this day.

  27. Hidden Markov Models:extensions • Many variants are now used. For example, the distribution of O may depend only on previous S, or also on previous O values, • pr(Ot | St , St-1 ,Ot-1 ,..) = pr(Ot| St ), or • pr(Ot | St , St-1 ,Ot-1 ,..) = pr(Ot | St ,St-1 ,Ot-1) . • Most importantly for us, the times of S and O may be decoupled, permitting the Observation corresponding to Statetimet to be a string whose length and composition depends on St(and possibly St-1 and part or all of the previous Observations). This is called a hidden semi-Markov or generalized hidden Markov model.

  28. Some current applications of HMM to biology mapping chromosomes aligning biological sequences predicting sequence structure inferring evolutionary relationships finding genes in DNA sequence Some early applications of HMM finance, but we never saw them speech recognition modelling ion channels In the mid-late 1980s HMMs entered genetics and molecular biology, and they are now firmly entrenched.

  29. The algorithms • As the name suggests, with an HMM the series O= (O1,O2 ,O3 ,……., OT) is observed, while the states S= (S1 ,S2 ,S3 ,……., ST) are not. • There are elegant algorithms for calculating pr(O|),arg max pr(O|) in certain specialcases, and arg maxSpr(S|O,). • Here  are the parameters of the model, e.g. transition and observation probabilities.

  30. Profile HMM = stochastic regular expressions M = Match state, I = Insert state, D = Delete state. To operate, go from left to right. I and M states output amino acids; B, D and E states are “silent”.

  31. How profile HMM are used • Instances of the motif are identified by calculating • log{pr(sequence | M)/pr(sequence | B)}, • where M and B are the motif and background HMM. • Alignments of instances of the motif to the HMM are found by calculating • arg maxstates pr(states | instance, M). • Estimationof HMM parameters is by calculating • arg maxparameterspr(sequences | M, parameters). • In all cases, we use the efficient HMM algorithms.

  32. Pfam domain-HMM • Pfam is a library of models of recurrent protein domains. They are constructed semi-automatically using profile hidden Markov models. • Pfam families have permanent accession numbers and contain functional annotation and cross-references to other databases, while Pfam-B families are re-generated at each release and are unannotated. • See http://pfam.wustl.edu/

  33. On the Modelling of Finding Short DNA Motifs

  34. Outline • Some Biological Background • Models and Modelling • Results and Discussions • Future Work

  35. Cartoon of gene structure (5’ Splice site) (3’ Splice site)

  36. 12 examples of 5’splice (donor) sites exon intron • TCGGTGAGT • TGGGTGTGT • CCGGTCCGT • ATG GTAAGA • TCT GTAAGT • CAGGTAGGA • CAGGTAGGG • AAGGTAAGG • AGGGTATGG • TGGGTAAGG • GAGGTTAGT • CATGTGAGT

  37. Probability models for short DNA motifs • Short:~6-20 base pairs • DNA motifs:splice sites, transcription factor binding sites, translation initiation sites,enhancers, promoters,... • Why probability models? • tocharacterizethe motifs • to helpidentifythem • forincorporationinto larger models • Aim: given a number of instances of a DNA sequence motif, we want a modelfor the probabilityof that motif.

  38. Weight matrix models, Staden (1984) • Base-3 -2 -10 +1 +2 +3 +4 +5 • A33 61 100 0 53 71 7 16 • C 37 13 30 0 3 8 6 16 • G 18 12 80 100 0 42 12 81 22 • T12 14 70 100 2 9 6 46 A weight matrix for donor sites. Essentially a mutual independencemodel. An improvement over the consensus CAGGTAAGT. But we have to go beyond independence…

  39. Beyond independence • Weight array matrices, Zhang & Marr (1993) consider dependencies between adjacent positions, i.e. (non-stationary) first-order Markov models. The number of parameters increases exponentially if we restrict to full higher-order Markovian models. • Variable length Markov models, Rissanen (1986), Buhlmann & Wyner (1999), help us get over this problem. In the last few years, many variants have appeared: all make use of trees. • [The interpolated Markov models of Salzberg et al (1998) address the same problem.]

  40. Some notation • L: length of the DNA sequence motif. • Xi: discrete random variable at position i, taking values from the set = {A, C, G, T}. • x= (x1, …, xL):a DNA sequence motifof length L. • x1j(j>1): the sequence (x1, x2, …., xj ). • P(x): probability of x.

  41. Variable Length Markov Models(Rissanen (1986), Buhlmann & Wyner (1999)) • Factorize P(x) in the usual telescopic way: • Simplify this using context functions • l = 2,..L, to

  42. VLMM cont. • A VLMM for a DNA sequence motif of length L is specified by • a distribution for X1, and, for l = 2,…L, • a constrained conditional distribution for Xl given Xl-1,…,X1. • That is, we need L-1 context functions.

  43. VLMM: an illustrative example X3 Full X2 X2 X2 X1 X3 X3 Pruned X2 X2 X2 X1 Pruned context: P(X3|X2=A, X1) = P(X3|X2=A), etc.

  44. Sequence dependencies(interactions) are not always local 3-dimensional folding; DNA, RNA & protein interactions The methods outlined so far all fail to incorporate long-range ( ≥4 bp) interactions. New model types are needed!

  45. Modelling “long-range” dependency • The principal work in this area is Burge & Karlin’s (1997) • maximal dependence decomposition(MDD) model. • Cai et al (2000) and Barash et al (2003) usedBayesian • networks (BN). • Yeo & Burge (2003) applied maximum entropy models. • Ellrott et al (2002) ordered the sequence and applied • Markov models to the motif. • We have adapted this last idea, to give permuted variable • length Markov models (PVLMM).

  46. Permuted variable length MMs (PVLMM) Let be a permutation vector. By using VLMM, simplify the context terms in the equation: The simplified equation has the form:

  47. Part of a context (decision) tree for position -2 of a splice donor PVLMM Node #s: counts Edge #s: split variables Sequence order: +2 +5 -1 +4 -2 +3 -3

  48. Maximal Dependence Decomposition • MDD starts with a mutual independence model as with WMMs. The data are then iteratively subdivided, at each stage splitting on the mostdependent position, suitably defined. At the tips of the tree so defined, a mutual independence model across all remaining positions is used. • The details can vary according to the splitting criterion (Burge & Karlin used 2), the actual splits (binary, etc), and the stopping rule. • However, the result is always a single tree.

  49. Parts of MDD trees for splice donors In each case, splits are into the most frequent nt vs the others.

More Related