kwa sey phd mph yingbo ma ms nannie song mph
Download
Skip this Video
Download Presentation
Kwa Sey, PhD, MPH Yingbo Ma, MS Nannie Song, MPH

Loading in 2 Seconds...

play fullscreen
1 / 29

Kwa Sey, PhD, MPH Yingbo Ma, MS Nannie Song, MPH - PowerPoint PPT Presentation


  • 102 Views
  • Uploaded on

Using Phylogenetic Analysis to Identify HIV Transmission Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010. Kwa Sey, PhD, MPH Yingbo Ma, MS Nannie Song, MPH . BACKGROUND.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Kwa Sey, PhD, MPH Yingbo Ma, MS Nannie Song, MPH' - jaimie


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
kwa sey phd mph yingbo ma ms nannie song mph
Using Phylogenetic Analysis to Identify HIV Transmission Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010

Kwa Sey, PhD, MPH

Yingbo Ma, MS

Nannie Song, MPH

slide2
BACKGROUND
  • Los Angeles County ranks second in nation only to New York City for highest number of living AIDS cases
  • Between 1982-2010, cumulative total of 75,114 persons with HIV/AIDS reported in LAC
  • Major transmission channels indicated by self-report:
    • male to male sex (79%)
    • heterosexual sex (12%)
    • injection drug use (9%)

*2010 Annual HIV Surveillance Report, January 2011:1-32, HIV Epidemiology Program., LAC-DPH

background
BACKGROUND
  • New techniques, such as phylogenetic analysis of HIV sequence data, can provide biological evidence for HIV transmission channels and signal emerging trends
what is phylogenetic analysis
What is Phylogenetic analysis?
  • The means of inferring evolutionary relationships through molecular sequencing data. The evolutionary history is usually depicted as a branching, treelike diagram
what is phylogenetic analysis1
What is Phylogenetic analysis?
  • Phylogenetic relationships used to infer epidemiological links among individuals, such as persons infected with HIV
  • Phylogenetic analysis used to understand patterns of HIV transmission among young black MSM in Mississippi.
  • (CDC, 2011)
hiv sequencing genotyping
HIV Sequencing/Genotyping

Schematic of HIV-1 particle

(in cross-section)

Viral genome

HIV GENOTYPING RESULT

ACTCTTTGGCAACGACCCCTTGTCACAATAAAGATAGGGGGGCAACAAAAGGAAGCTCTATTAG…

Fragment of the pol region for VARHS genotyping: 1020 nucleotides

guidelines for genotyping
Guidelines for genotyping
  • Genotyping now recommended for all newly diagnosed HIV infected individuals, presenting us with increasingly comprehensive HIV sequence data and opportunity to investigate population level HIV transmission patterns
objectives
OBJECTIVES
  • Objective of this analysis to use phylogenetic analyses to characterize HIV transmission channels in Los Angeles County
methods
METHODS
  • Obtained HIV genomic sequences from VARHS (Variant Atypical and Resistant HIV Surveillance System)
  • VARHS
    • extension of the existing national population-based HIV/AIDS case surveillance system
    • coordinated and funded by CDC
  • Since 2006, as part of VARHS, the LAC DHSP HIV Epidemiology has obtained HIV pol region genetic sequences from county residents newly diagnosed with HIV
methods1
METHODS

For inclusion in this analysis, cases had to be:

  • LAC residents
  • Newly diagnosed with HIV
  • Reported to eHARS following a confidential HIV test
  • Antiretroviral naïve
  • Have available genomic sequence (pol region) data from specimen collected within 3 months of diagnosis
  • .
methods2
METHODS
  • Obtained genetic sequencing data for 1,407 (29%) out of 4933 LAC HIV cases diagnosed between 2009 and 2010
  • HIV sequence data merged with demographic and risk behavior data from the Enhanced HIV/AIDS Reporting System (eHARS)
methods3
METHODS
  • Neighbor joining phylogenetic analysis performed on pol sequence spanning protease and reverse transcriptase
  • Nucleotide distances calculated using Kimura's two-parameter method in MEGA5, with 1000 bootstrap replications
  • Transmission clusters defined as sequences that had:
    • common node of bootstrap values greater than 95% and
    • average genetic distance lower than 0.015 nucleotide substitutions per site
age at hiv diagnosis
Age at HIV diagnosis

Average age: 33 years.

slide18
MSM Cluster- 56%

MSM/IDU Cluster- 6%

MSM/HET Cluster- 6%

IDU/HET Cluster- 6%

Identified 16 clusters, representing 49 cases.

Each cluster comprised of 3-4 cases.

Clusters categorized into 4 cluster types.

All subtype B.

msm transmission channel
MSM,19yrs, White, USA-born

100

MSM, 21yrs, White, USA-born

98

MSM, 25yrs, Latino/Hispanic, USA-born

99

MSM, 20yrs, Black/African American, USA-born

0.005

“MSM” Transmission Channel
  • This cluster of 4 represents the “MSM” Transmission Channel.
msm idu transmission channel
MSM, 48yrs, White, Unknown origin, K103N

99

100

MSM, 41yrs, White, USA-born, K103N

Male IDU, 31yrs,Black/African American, USA-born

0.005

“MSM/IDU” Transmission Channel
  • This cluster of 3 represents “MSM/IDU” Transmission Channel.
idu het female transmission channel
Male Child, 2, Latino/Hispanic, USA-born

Female IDU,18, Latino/Hispanic, USA-born

100

Female HET, 39, Latino/Hispanic, USA-born

99

0.005

“IDU/HET Female” Transmission Channel
  • This cluster of 3 represents IDU/HET female transmission channel.
msm het transmission channel
Female HET,19, Latino/Hispanic, Mexico-born

100

Female HET , 35, Latino/Hispanic, USA-born

99

MSM, 56, Latino/Hispanic, Mexico-born

0.005

“MSM/HET” Transmission Channel
  • This cluster of 3 represents MSM/HET transmission channel.
discussion
DISCUSSION
  • The results provide biological evidence for the major HIV transmission channels that have previously been established by traditional epidemiological data.
  • Small sample size limits the inferences that may be made based on this data.
conclusions
CONCLUSIONS
  • Phylogenetic analysis has potential to serve as additional source of information to validate descriptions of local HIV epidemics inferred from self-reported behavioral data and case studies
contact information
CONTACT INFORMATION

KwaSey PhD, MPH

600 S. Commonwealth Ave. Suite 1920

Los Angeles,CA90005

[email protected]

slide29
MSM Only Cluster- 75%

MSM/IDU Cluster- 13%

IDU/HET Cluster- 3%

MSM/HET Cluster- 6%

Other/Unknown Cluster- 3%

85% Boot strap Value Cutoff: 32 clusters, representing 110 cases, were identified. Each of these clusters comprised of 3-6 cases. The clusters were categorized into 5 cluster types. All were subtype B.

ad