jaeger
Uploaded by
37 SLIDES
539 VIEWS
370LIKES

Dr. Jason D. Bakos Assistant Professor Heterogeneous and Reconfigurable Computing Lab (HeRC)

DESCRIPTION

Heterogeneous Computing at USC Dept. of Computer Science and Engineering University of South Carolina. Dr. Jason D. Bakos Assistant Professor Heterogeneous and Reconfigurable Computing Lab (HeRC).

1 / 37

Download Presentation

Dr. Jason D. Bakos Assistant Professor Heterogeneous and Reconfigurable Computing Lab (HeRC)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Heterogeneous Computing at USCDept. of Computer Science and EngineeringUniversity of South Carolina Dr. Jason D. Bakos Assistant Professor Heterogeneous and Reconfigurable Computing Lab (HeRC) This material is based upon work supported by the National Science Foundation under Grant Nos. CCF-0844951 and CCF-0915608.

  2. Heterogeneous Computing • Subfield of computer architecture • Mix general-purpose CPUs with specialized processors • Becoming increasingly popular with high integration densities • GOALs: • Explore the use of specialized processor designs that are designed with radically different designs than traditional CPUs • Develop new programming models and methodologies for these processors

  3. Minimum Feature Size

  4. CPU Design FOR i = 1 to 1000 C[i] = A[i] + B[i] Core 1 Core 2 CPU Control ALU ALU Control ALU ALU ALU ALU ALU ALU time L1 cache L1 cache Copy part of A onto CPU L2 cache L2 cache Copy part of B onto CPU ADD ADD ADD ADD Copy part of C into Mem L3 cache Copy part of A onto CPU Copy part of B onto CPU ADD ADD ADD ADD Copy part of C into Mem …

  5. Co-Processor Design FOR i = 1 to 1000 C[i] = A[i] + B[i] GPU cache ALU ALU ALU ALU ALU ALU ALU ALU Core 1 cache ALU ALU ALU ALU ALU ALU ALU ALU Core 2 cache ALU ALU ALU ALU ALU ALU ALU ALU Core 3 cache ALU ALU ALU ALU ALU ALU ALU ALU Core 4 cache ALU ALU ALU ALU ALU ALU ALU ALU Core 5 cache ALU ALU ALU ALU ALU ALU ALU ALU Core 6 cache ALU ALU ALU ALU ALU ALU ALU ALU Core 7 cache ALU ALU ALU ALU ALU ALU ALU ALU Core 8

  6. Heterogeneous Computing • General purpose CPU + special-purpose processors in one system System I/O controller QPI PCIe Host Memory CPU On board Memory X58 Co-processor ~25 GB/s ~25 GB/s ~8 GB/s (x16) ????? ~150 GB/s for GeForce 260 host add-in card

  7. Heterogeneous Computing • Combine CPUs and coprocs • Example: • Application requires a week of CPU time • Offload computation consumes 99% of execution time initialization 0.5% of run time 49% of code “hot” loop 99% of run time 2% of code clean up 0.5% of run time 49% of code co-processor

  8. NVIDIA GPU Architecture • Hundreds of simple processor cores • Core design: • Only one instruction from each thread active in the pipeline at a time • In-order execution • No branch prediction • No speculative execution • No support for context switches • No system support (syscalls, etc.) • Small, simple caches • Programmer-managed on-chip scratch memory

  9. Programming GPUs HOST (CPU) code: dim3 grid,block; grid.x=((VECTOR_SIZE/512) + (VECTOR_SIZE%512?1:0)); block.x=512; cudaMemcpy(a_device,a,VECTOR_SIZE * sizeof(double),cudaMemcpyHostToDevice); cudaMemcpy(b_device,b,VECTOR_SIZE * sizeof(double),cudaMemcpyHostToDevice); vector_add_device<<<grid,block>>>(a_device,b_device,c_device); cudaMemcpy(c_gpu,c_device,VECTOR_SIZE * sizeof(double),cudaMemcpyDeviceToHost); GPU code: __global__ void vector_add_device (double *a,double *b,double *c) { __shared__ double a_s,b_s,c_s; a_s=a[blockIdx.x*blockDim.x+threadIdx.x]; b_s=b[blockIdx.x*blockDim.x+threadIdx.x]; c_s=a_s+b_s; c[blockIdx.x*blockDim.x+threadIdx.x]=c_s; }

  10. IBM Cell/B.E. Architecture • 1 PPE, 8 SPEs • Programmer must manually manage 256K memory and threads invocation on each SPE • Each SPE includes a vector unit like the one on current Intel processors • 128 bits wide

  11. High-Performance Reconfigurable Computing • Heterogeneous computing with reconfigurable logic, i.e. FPGAs

  12. Field Programmable Gate Arrays

  13. Programming FPGAs

  14. Heterogeneous Computing with FPGAs Annapolis Micro Systems WILDSTAR 2 PRO GiDEL PROCSTAR III

  15. Heterogeneous Computing with FPGAs Convey HC-1

  16. Heterogeneous Computing with GPUs NVIDIA Tesla S1070

  17. Heterogeneous Computing now Mainstream:IBM Roadrunner • Los Alamos, fastest computer in the world in 2008 (still in Top 10) • 6,480 AMD Opteron (dual core) CPUs • 12,960 PowerXCell 8i GPUs • Each blade contains 2 Operons and 4 Cells • 296 racks • First ever petaflop machine (2008) • 1.71 petaflops peak (1.7 billion million fp operations per second) • 2.35 MW (not including cooling) • Lake Murray hydroelectric plant produces ~150 MW (peak) • Lake Murray coal plant (McMeekin Station) produces ~300 MW (peak) • Catawba Nuclear Station near Rock Hill produces 2258 MW

  18. Research Problems • What is the best way to design coprocessors? How can we make them faster and easier to program? • Approach: Perform design-space exploration using simulations, mostly in the hands of big companies • What is the best way to design heterogeneous machines? How do we interconnect the CPU and coprocessors? • Approach: PCI-express was the enabler of modern heterogeneous systems and QPI and Hypertransport may make things even easier in the future • However, scalability is still a major problem, right now people use hierarchical systems • How well do certain types of (scientific) programs run on heterogeneous machines? What benefit should we expect? • Approach: Perform “by hand” acceleration of specific applications and report results • How do you modify an arbitrary program to run on a heterogeneous machine? • Approach: Same as above, but use these experiences to develop new development tools and methodologies that are general-purpose

  19. Our Group: HeRC • Applications work • Computational phylogenetics (FPGA/GPU) • GRAPPA and MrBayes • Sparse linear algebra (FPGA/GPU) • Matrix-vector multiply, double-precision accumulators • Data mining (FPGA/GPU) • Logic minimization (GPU) • System architecture • Multi-FPGA interconnects • Tools • Automatic partitioning (PATHS) • Micro-architectural simulation for code tuning

  20. Application: Phylogenies genus Drosophila

  21. Application: Phylogenies g1 g3 g4 g2 g1 g3 g2 g5 g5 g5 g6 g4 g6 • Unrooted binary tree • n leaf vertices • n - 2 internal vertices (degree 3) • Tree configurations = • (2n - 5) * (2n - 7) * (2n - 9) * … * 3 • 200 trillion trees for 16 leaves g4 g1 g6 g5 g2 g3 g5

  22. Our Applications Work • FPGA-based co-processors for computational biology 1000X speedup! Tiffany M. Mintz, Jason D. Bakos, "A Cluster-on-a-Chip Architecture for High-Throughput Phylogeny Search," IEEE Trans. on Parallel and Distributed Systems, in press. Stephanie Zierke, Jason D. Bakos, "FPGA Acceleration of Bayesian Phylogenetic Inference," BMC Bioinformatics, in press. Jason D. Bakos, Panormitis E. Elenis, "A Special-Purpose Architecture for Solving the Breakpoint Median Problem," IEEE Transactions on Very Large Scale Integration (VLSI) Systems, Vol. 16, No. 12, Dec. 2008. Jason D. Bakos, Panormitis E. Elenis, Jijun Tang, "FPGA Acceleration of Phylogeny Reconstruction for Whole Genome Data," 7th IEEE International Symposium on Bioinformatics & Bioengineering (BIBE'07), Boston, MA, Oct. 14-17, 2007. Jason D. Bakos, “FPGA Acceleration of Gene Rearrangement Analysis,” 15th Annual IEEE International Symposium on Field-Programmable Custom Computing Machines (FCCM'07), April 23-25, 2007. 10X speedup!

  23. Our Applications Work • FPGA-based co-processors for linear algebra Krishna.K. Nagar, Jason D. Bakos, "A High-Performance Double Precision Accumulator," IEEE International Conference on Field-Programmable Technology (IC-FPT'09), Dec. 9-11, 2009. Yan Zhang, Yasser Shalabi, Rishabh Jain, Krishna K. Nagar, Jason D. Bakos, "FPGA vs. GPU for Sparse Matrix Vector Multiply," IEEE International Conference on Field-Programmable Technology (IC-FPT'09), Dec. 9-11, 2009. Krishna K. Nagar, Yan Zhang, Jason D. Bakos, "An Integrated Reduction Technique for a Double Precision Accumulator," Proc. Third International Workshop on High-Performance Reconfigurable Computing Technology and Applications (HPRCTA'09), held in conjunction with Supercomputing 2009 (SC'09), Nov. 15, 2009. Jason D. Bakos, Krishna K. Nagar, "Exploiting Matrix Symmetry to Improve FPGA-Accelerated Conjugate Gradient," 17th Annual IEEE International Symposium on Field Programmable Custom Computing Machines (FCCM'09), April 5-8, 2009.

  24. Our Applications Work • FPGA-based co-processors for linear algebra Krishna.K. Nagar, Jason D. Bakos, "A High-Performance Double Precision Accumulator," IEEE International Conference on Field-Programmable Technology (IC-FPT'09), Dec. 9-11, 2009. Yan Zhang, Yasser Shalabi, Rishabh Jain, Krishna K. Nagar, Jason D. Bakos, "FPGA vs. GPU for Sparse Matrix Vector Multiply," IEEE International Conference on Field-Programmable Technology (IC-FPT'09), Dec. 9-11, 2009. Krishna K. Nagar, Yan Zhang, Jason D. Bakos, "An Integrated Reduction Technique for a Double Precision Accumulator," Proc. Third International Workshop on High-Performance Reconfigurable Computing Technology and Applications (HPRCTA'09), held in conjunction with Supercomputing 2009 (SC'09), Nov. 15, 2009. Jason D. Bakos, Krishna K. Nagar, "Exploiting Matrix Symmetry to Improve FPGA-Accelerated Conjugate Gradient," 17th Annual IEEE International Symposium on Field Programmable Custom Computing Machines (FCCM'09), April 5-8, 2009.

  25. Streaming Double Precision Accumulation • FPGAs allow data to be “streamed” into a computational pipeline • Many kernels targeted for acceleration include • Such as: dot product, used for MVM: kernel for many methods • For large datasets, values delivered serially to an accumulator • Reduction operation G+H+I, set 3 D+E+F, set 2 A+B+C, set 1 Σ I, set 3 H, set 3 G, set 3 F, set 2 E, set 2 D, set 2 C, set 1 B, set 1 A, set 1

  26. The Reduction Problem Feedback Loop Basic Accumulator Architecture + Adder Pipeline Partial sums Reduction Ckt Control Required Design Mem Mem

  27. Sparse Matrix-Vector Multiply 0 1 2 3 4 5 6 7 8 9 10 A 0 0 0 B 0 val A B C D E F G H I J K 0 0 0 C 0 D E 0 0 0 F G col 0 4 3 5 0 4 5 0 2 4 3 H 0 0 0 0 0 0 0 I 0 J 0 0 2 4 7 8 10 11 ptr 0 0 0 K 0 0 • Group vol/col • Zero-terminate (A,0) (B,4) (0,0) (C,3) (D,4) (0,0)…

  28. New SpMV Architecture • Delete tree, replicate accumulator, schedule matrix data: 400 bits

  29. Performance Comparison If FPGA Memory bandwidth scaled by adding multipliers/ accumulators to match GPU Memory Bandwidth for each matrix separately

  30. Sequence Alignment • DNA/protein sequence, e.g. • TGAGCTGTAGTGTTGGTACCC => TGACCGGTTTGGCCC • Goal: align the two sequences against substitutions and deletions: • TGAGCTGTAGTGTTGGTACCC • TGAGCTGT----TTGGTACCC • Used for sequence comparison and database search

  31. GPU and FPGA Acceleration of Data Mining Minimum support=2 <BCE> <ABC>, <ABE>, <ACE>, <BCE>

  32. Our Applications Work • GPU Acceleration of Two Level Logic Minimization • 1. Ibrahim Savran, Jason D. Bakos, "GPU Acceleration of Near-Minimal Logic Minimization," 2010 Symposium on Application Accelerators in High Performance Computing (SAAHPC'10), July 13-15, 2010. A’B’CD A’B’C’D A’B’ A’B’D’ A’B’CD A’B’CD’ A’C A’BC (ACD)’ (A’BC’D)’

  33. Our Projects • GPU Simulation • Patrick A. Moran, Jason D. Bakos, "A PTX Simulator for Performance Tuning CUDA Code," IEEE Trans. on Parallel and Distributed Systems, submitted. • Multi-FPGA System Architectures • Jason D. Bakos, Charles L. Cathey, E. Allen Michalski, "Predictive Load Balancing for Interconnected FPGAs," 16th International Conference on Field Programmable Logic and Applications (FPL'06), Madrid, Spain, August 28-30, 2006. • Charles L. Cathey, Jason D. Bakos, Duncan A. Buell, "A Reconfigurable Distributed Computing Fabric Exploiting Multilevel Parallelism," 14th Annual IEEE International Symposium on Field-Programmable Custom Computing Machines (FCCM'06), April 24-26, 2006.

  34. PATHS: Task Partitioning forHeterogeneous Computing

  35. High-Level Synthesis • Input bandwidth-constrained high-level synthesis • Example: 16-input expression: out = (AA1 * A1 + AC1 * C1 + AG1 * G1 + AT1 * T1) * (AG2 * A2 + AC2 * C2 + AG2 * G2 + AT2 * T2)

  36. Contact Information • Jason D. Bakos • Office: 3A52 • E-mail: jbakos@sc.edu • http://www.cse.sc.edu/~jbakos • Heterogeneous and Reconfigurable Computing (HeRC) Lab: • Lab: 3D15 • http://herc.cse.sc.edu

  37. Acknowledgement Krishna Nagar Tiffany Mintz Jason Bakos Yan Zhang Zheming Jin Heterogeneous and Reconfigurable Computing Group http://herc.cse.sc.edu

More Related