jackson-daniel
Uploaded by
18 SLIDES
461 VIEWS
190LIKES

Mass Spectrometry

DESCRIPTION

Mass Spectrometry. Separation principle: A particle with a certain mass (m) and a certain charge (z) behaves in a predictable manner when exposed to a electromagnetic (EM) field. By measuring this response, the ratio of the two variables (m/z) can be determined. First approach:

1 / 18

Download Presentation

Mass Spectrometry

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Mass Spectrometry Separation principle: A particle with a certain mass (m) and a certain charge (z) behaves in a predictable manner when exposed to a electromagnetic (EM) field. By measuring this response, the ratio of the two variables (m/z) can be determined. First approach: Ionize the particle Accelerate the particle by an electric field Modify the flight-path of the particle with a magnetic field Measure the effect of the magnetic field

  2. chamber of ionized particles magnet Acceleration Photographic plate Atmospheric pressure Vacuum The First Mass Spectrometer:The Magnetic Sector (m/z)3 (m/z)1 (m/z)2

  3. Other Types of Mass Spectrometers • Quadropole • only ions of known m/z can pass through at a given EM field generated by four poles (quadropole). • Ion Trap • only ions of known m/z can reach the detector, others are kept spinning in circles by an EM field generated by four poles. • Time of Flight • the accelerated ions travel a known length and the time it takes is directly related to the m/z ratio. • Ion Cyclotron (Fourier Transform) • similar to Ion Trap, six poles instead of four, the decay of the induced electric current of all the spinning ions is measured and transformed to frequency distribution, which is directly related to the m/z ratio.

  4. Intensity Time  m/z Time of Flight Mass Spectrometer Atmospheric pressure Vacuum Field free region detector acceleration ionized particles Can only be performed in high vacuum to minimize collisions between ions of different mass or other gaseous moyeties

  5. gaseous plume charge formation laser ablation sample - - - + + + - - + + + + - - - + - + + - - - - + + laser Matrix Assisted Laser Desorption Ionization • produces mainly singly charged ions • pulsed ionization, perfect match to TOF MS • a “soft” ionization, good for sensitive biomolecules • fairly tolerant of impurities such as salts and detergents

  6. Sample Clean-Up

  7. Ethanol Precipitation

  8. GenoPure

  9. ZipTipnon-autoclaved water

  10. Primer m/z ddC 273.3 m/z 15 288.2 ddT m/z 9 297.2 ddA m/z 16 313.2 ddG m/z Single Base Extension

  11. Single Base ExtensionPrimer W1156 (22mer) TGCTATACCAAGTTTCCATAAA C/A A C C C A A A T A T

  12. W1156Sample 709C ΔM=312.7 Da

  13. W1156Sample 712C ΔM1=313.0 Da ΔM2=297.1 Da

  14. W1156Sample 713C ΔM=296.5 Da

  15. W1156Control (no DNA) ΔM=301.3 Da

  16. Results of primer W1156 Mass difference error compared to theoretical masses: (ΔMmeas- ΔMddNTP)/ ΔMddNTP From FP experiments: 709C – Homozygote, type B (ddG) 712C – Heterozygote 713C – Homozygote, type A (ddA)

  17. Primer W1488 (34mer)

  18. W1488 Sample 713C ΔM=296 Da

More Related