slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
ATG TTCTTCCCC TCC TGA GGGGAAGAA TTA M F F P S * G E E L PowerPoint Presentation
Download Presentation
ATG TTCTTCCCC TCC TGA GGGGAAGAA TTA M F F P S * G E E L

Loading in 2 Seconds...

play fullscreen
1 / 2

ATG TTCTTCCCC TCC TGA GGGGAAGAA TTA M F F P S * G E E L - PowerPoint PPT Presentation


  • 90 Views
  • Uploaded on

TARGETED ENDONUCLEASES. VIRUS ELEMENTS. Plant Infection. Plant with defective GUS. ATG TTCTTCCCC TCC TGA GGGGAAGAA TTA M F F P S * G E E L NON-ACTIVE GUS ENZYME. ATG TTCTTCCCC TCC TGA GGGGAAGAA TTA

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'ATG TTCTTCCCC TCC TGA GGGGAAGAA TTA M F F P S * G E E L' - italia


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

TARGETED ENDONUCLEASES

VIRUS ELEMENTS

Plant Infection

Plant with defective GUS

ATGTTCTTCCCCTCCTGAGGGGAAGAATTA

M F F P S * G E E L

NON-ACTIVE GUS ENZYME

ATGTTCTTCCCCTCCTGAGGGGAAGAATTA

M F F P S * G E E L

ACTIVE GUS ENZYME

X

slide2

Modified Shoots

Petunia plant expressing GUS

T1/T2 Seedlings

Pet 40-3-2 CATGTTCTTCCCCTC - - - AGGGGAAGAATAA

Pet 40-3-4 CATGTTCTTCCCCTC - - - AGGGGAAGAATAA

Pet 40-3-6 CATGTTCTTCCCCTC - - - AGGGGAAGAATAA

Pet 40-3-8 CATGTTCTTCCCCTC - - - AGGGGAAGAATAA

Pet 40-3-9 CATGTTCTTCCCCTC - - - AGGGGAAGAATAA

Pet 40-3-15 CATGTTCTTCCCCTC - - - AGGGGAAGAATAA

QQR-STOP GUS CATGTTCTTCCCCTC CTG AGGGGAAGAATAA

MemoGene™allows for tailor-made varieties with new traits