slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Supplement 1: What is @INC? PowerPoint Presentation
Download Presentation
Supplement 1: What is @INC?

Loading in 2 Seconds...

play fullscreen
1 / 9

Supplement 1: What is @INC? - PowerPoint PPT Presentation


  • 52 Views
  • Uploaded on

Supplement 1: What is @INC? The @INC is an array that contains a list of directories Perl searches when attempting to load modules. To display the current contents of the @INC array: perl -e 'print join "\n", @INC‘ or perl -V the equivalent to the shell's PATH variable

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Supplement 1: What is @INC?' - idalee


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Supplement 1: What is @INC?

The @INC is an array that contains a list of directories Perl searches when

attempting to load modules.

To display the current contents of the @INC array:

perl -e 'print join "\n", @INC‘ or perl -V

the equivalent to the shell's PATH variable

When you use a module in your code, for example

Use Getopt::Std;

Perl gets a list of directories from the @INC variable and searches them for Getopt::Std

module it is requested to load. If the file that you want to load is

not located in one of the listed directories, then you have to tell Perl where to find the file.

You can either provide a path relative to one of the directories in @INC,

or you can provide the full path to the file.

slide2

#!/usr/bin/perl

BEGIN {

unshift (@INC,"/usr/local/biobin"); # Add the modules stored to the @INC

}

use Oligo_biobin;

if (@ARGV < 1) { die "Usage: $0 <tbl_file>

Tbl_file: OligoidOligosequence“

;}

( $oligofile ) = @ARGV;

open (TBL,"$oligofile") || die "Can't open $oligofile";

while (<TBL>) {

chomp;

$temp = $_;

@line = split "\t",$_;

print "$line[0]\t$line[1]\t";

print sprintf "%5.1f\n",&calc_tm($line[1]);

slide3

Supplemental 2: What is <>?

#! /usr/bin/perl

while (<>) {

print $_;

}

Perl diamond.pl file1.txt file2.txt

Diamond operator reads each line of file1.txt then followed by each line of file2.txt

slide5

Compaction

efficiency

= 6 fold x 40 fold x 700 fold

15-18 loops

1200 kb

DNA

Nucleosomes

Each loop 180-300

nucleosomes, 50-70

kbDNA

Scaffold

30 nm solenoid

Supplemental 3. What

slide6

open chromatin

promoter

enhancer

gene

compact chromatin

(transcribed

enhancer

region)

LCR

(regulated)

MAR

MAR

MAR

LCR

nuclear scaffold

J. Bode / E. Wingender 1993

insulator

slide7

Chromosome: how long is it?

Human chromosome 1: 250 million base pairs (bp)

ATCGCGATTGCCATGCCGATCGGTAAACT…

The other strand is implied:

ATCGCGATTGCCATGCCGATCGGTAAACT…

TCGCGCTAACGGTACGGCTAGCCATTTGA…

Human genome sequence:

24 chromosome: 3,101,788,170 bp

3 G if loaded into computer memory

One base pair

slide8

Genome Sequences of various species:

ftp://ftp.ncbi.nih.gov/genomes/

Conception of gene

Transcription

Promoter 5’UTR Exon1 Intron1 Exon2 Intron2 Exon3 3’UTR

Pre-mRNA

Mature mRNA

5’UTR Exon1 Intron1 Exon2 Intron2 Exon3 3’UTR

5’UTR Exon1 Exon2 Exon3 3’UTR

Translation

Protein

slide9

DNA sequence format

Fasta

> Chr1

ATCGAATGCTGA…

>Chr2

TTGACTCTGATG…

Table format (for perlmaniulation)

Chr1 ATCGAATGCTGA …

Chr2 TTGACTCTGATG…