hornt
Uploaded by
30 SLIDES
329 VIEWS
300LIKES

DNA, RNA, and Protein Synthesis in Molecular Biology

DESCRIPTION

Explore the essential processes of DNA transcription and translation in cell biology, including the roles of mRNA, rRNA, tRNA, and ribosomes in protein synthesis. Learn about the central dogma of gene expression, transcription steps, and eukaryotic gene splicing.

1 / 30

Download Presentation

DNA, RNA, and Protein Synthesis in Molecular Biology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. 1. Important Features • a. DNA contains genetic template" for proteins. • b. DNA is found in the nucleus • c. Protein synthesis occurs in the cytoplasm - ribosome. • d. "Genetic information" must be transferred to the cytoplasm where proteins are synthesized.

  2. 2. Processes of Protein Synthesis • a. Transcription - genetic template for a protein is copied and carried out to the cytoplasm • b. Translation - template serves as a series of codes for the amino acid sequence of the protein

  3. Cells Use RNA to Make Protein • The RNA Players – mRNA, rRNA, tRNA • During polypeptide synthesis, ribosomal RNA (rRNA) is the site of polypeptide assembly. • Transfer RNA (tRNA) transports and positions amino acids. • Messenger RNA (mRNA) directs which amino acids are assembled into polypeptides. • Central Dogma • DNA  RNA Protein

  4. Central Dogma of Gene Expression

  5. Gene Expression • Transcription – in the nucleus (if you have one) • DNA sequence is transcribed into RNA sequence • initiated when RNA polymerase binds to promoter binding site • moves along DNA strand and adds corresponding complementary RNA nucleotide • disengages at stop signal

  6. 3. Steps of Transcription a. DNA unwinds b. One side of DNA "codes for a protein" c. Genetic code of DNA is a triplet code of 3 nucleotides or bases d. Each triplet is specific for the coding of a single amino acid e. Sequence of triplet codes on DNA will specify the amino acid sequence on the protein f. Major step is the synthesis of the coded "messenger" molecule – mRNA g. mRNA is "transcribed" from DNA by complementary base pairing (mRNA has no thymine, which is replaced by uracil) h. mRNA passes out to cytoplasm to the ribosome

  7. Transcription • RNA polymerase • only one of two DNA strands (template) is transcribed • non-transcribed strand is termed coding strand - same as RNA (except T’s are U’s) • In both bacteria and eukaryotes, the polymerase adds ribonucleotides to the growing 3’ end of an RNA chain. • synthesis proceeds in 5’3’ direction

  8. Transcription Bubble

  9. Transcription • Promoter • Transcription starts at RNA polymerase binding sites called promoters on DNA template strand. • Initiation • Other eukaryotic factors bind, assembling a transcription complex. • RNA polymerase begins to unwind DNA helix.

  10. Transcription • Elongation • Transcription bubble moves down DNA at constant rate leaving growing RNA strands protruding from the bubble. • Termination • Stop sequences at the end of the gene cause phosphodiester bond formation to cease, transcription bubble to dissociate, and RNA polymerase to release DNA.

  11. Transcription • Eukaryotic transcription differs from prokaryotic transcription: • three RNA polymerase enzymes • initiation complex forms at promoter • RNAs are modified after transcription

  12. Spliced Gene Transcripts • DNA sequence specifying a protein is broken into segments (exons) scattered among longer noncoding segments (introns). • Initially, primary RNA transcript is produced for the entire gene. • Small nuclear ribonuclearproteins (snRNPs) associate with proteins to form spliceosomes. • Excise introns and splice exons to form mature mRNA.

  13. RNA Splicing • During RNA processing, intron sequences are cut out of primary transcript before it is used in polypeptide synthesis. • remaining exon sequences are spliced together to form final processed mRNA

  14. Eukaryotic Genes are Fragmented

  15. Now TRANSLATION!!!!

  16. 4. Translation overview a. mRNA attaches to the ribosome b. tRNA's attach to free amino acids in the cytoplasmic "pool" of amino acids c. tRNA carries its specific amino acid to the ribosome

  17. Translation overview (cont.) d. tRNA "delivers" its amino acid based on complementary pairing of a triplet code (anticodon) with the triplet code (codon) of the mRNA. e. Enzyme "hooks" the amino acid to the last one in the chain forming a peptide bond. f. Protein chain continues to grow as each tRNA brings in its amino acid and adds it to the chain. - This is translation!!

  18. Gene Expression • Translation – in the cytoplasm at ribosome • nucleotide sequence of mRNA transcript is translated into amino acid sequence in the polypeptide • rRNA recognizes and binds to start sequence • moves three nucleotides at a time • disengages at stop signal • Gene expression - collective of transcription and translation

  19. Translation • Begins when initial portion of mRNA molecule binds to rRNA in a ribosome • tRNA molecule with complimentary anticodon binds to exposed codon on mRNA • some tRNA molecules recognize more than one codon

  20. Translation • Start and stop signals • start signal coded by AUG codon • stop signal coded by one of three nonsense codons: UAA - UAG - UGA • Initiation • Polypeptide synthesis begins with the formation of an initiation complex. • initiation factors

  21. Translation • Translocation • ribosome moves nucleotides along mRNA molecule

  22. Translation • Termination • Nonsense codons are recognized by release factors that release the newly made polypeptide from the ribosome.

  23. Genetic Code • Genetic code consists of a series of information blocks called codons. • reading frame (triplet) • each codes for one amino acid • genetic code is nearly universal • mitochondria • chloroplasts

  24. The Genetic Code 1. A triplet code comprised of three nucleotide bases in a sequence. 2. How many triplet codes? 20 common amino acids in a protein 4 diff. bases on DNA A,T,C, & G | | | | 4 diff. bases on RNA U,A,G, & C 4 things put together in combinations of 3 = 43= 64 Therefore - 64 different DNA triplet codes or RNA codons

  25. The 64 triplet codes • 60 code for amino acids • 4 act as "stop" and "start codes • Degenerate Code- more than one triplet code for some amino acids e.g., GGG GGU GGC GGA All code for the amino acid glycine

  26. Differences Between Prokaryotic and Eukaryotic Gene Expression • Most eukaryotic genes possess introns. • Individual bacterial mRNA molecules often contain transcripts of several genes. • Eukaryotic mRNA molecules must be completely formed and must pass across the nuclear membrane before translation. • In prokaryotes, translation begins at the AUG codon preceded by a special nucleotide sequence.

  27. Differences Between Prokaryotic and Eukaryotic Gene Expression • Eukaryotic mRNA molecules have introns cut out and exons joined together before translation. • Eukaryotic ribosomes are larger than prokaryotic ribosomes.

  28. Challenge Question DNA Template: mRNA (?) 3’ 5’ (?) 3’ 5’ mRNA: GGTCAGTATTATTACGCGACGGGCAATCCGCACGTGTCATCAATAGTGCCTTCGTCTGAGATC Polypeptide:

More Related