ALDOLASE - PowerPoint PPT Presentation

hop
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
ALDOLASE PowerPoint Presentation
play fullscreen
1 / 12
Download Presentation
ALDOLASE
393 Views
Download Presentation

ALDOLASE

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. ALDOLASE By: Tiffany J. Simmons Pd. 6

  2. Amino Acid Sequence-Aldolase GGTCCAATGCCCGCCAGCCTAGCTCCAGTGCTTCTAGTAGGAGGGCTGAAAGGGAGCAACTTTTCCTCCAATCCTGGAAATTCGACACAATTAGATTTG AACTC GCTGGAAATACAACACATGTTAAATCTTAAGTACAAGGGGGAAAAAATAAATCAGTTATTTGAAACATAAAAATGAATACCAAGGACCTGATCAAATTTCACACAGCAGTTTCC TTGCAACAC(TTCAGCTCCCCATGCTCCAGAATACCCACCCAAGAAAATAATAGGCTTTAAAACAATATCGGCTCCTCATCCAAAGAACAACTGCTGATTGAAACACCTCATTAGCT GTGTAGAGAAGTGCATCTTATGAAACAGTCTTAGCAGTGGTAGGTTGGGAAGGAGATAG

  3. Another Version Rabbit A -Ala Leu Ser Asp His His Ile Tyr LeuGluGlyThrLeuLeu Lys Pro Asn Met Val Thr Pro Gly His Ala CysThr Gin Lys Frog A- Ala Leu Ser Asx His His Val Tyr LeuGlxGlyThrLeuLeu Lys Pro Asx Met Val Thr Ala GlyAsx Ala CysThrGlx Lys Cod A- Ala Leu Ser Asp His His Val Tyr Leu Gin GlyThrLeuLeu Lys Pro Asp Met Val Thr Ala Gly His Ser CysThr Gin Lys Rabbit C- Ala Leu Ser Asx His His Ile Tyr Val GixGlyThrLeuLeu Lys Pro Glx Met Val Thr Pro GlyAsx Ala CysThrGlx Lys Rabbit B- Ala LeuAsn Asp His His Val Tyr LeuGluGlyThrLeuLeu Lys Pro Asn Met Val Thr Ala Gly His Ala CysThr Lys Ox B- Ala LeuAsn Asp His His Val Tyr LeuGluGlyThrLeuLeu Lys Pro Asn Met Val Thr Ala Gly His Ala CysThr Lys Lys Rat B- Ala LeuAsn Asp His His Val Tyr LeuGluGlyThrLeuLeu Lys Pro Asn Met LeuThr Ala Gly His Ala CysThr Lys Lys Human-Ala LeuAsn Asp His His Val Tyr LeuGluGlyThrLeuLeu Lys Pro Asn Met Val Thr Ala Gly His Ala CysThr Lys Lys

  4. Protein Structure ATGGCCCACCGATTTCCAGCCCTCACCCAGGAGCAGAAGAAGGAGCTCTCAGAAATTQCCCAGAGCATTGTTGCCAATTCAGAAATTGCCCAGAGCATTGTTGCCCAT Primary Structure Secondary Structure By: Tiffany J. Simmons Pd. 6

  5. Tertiary Structure

  6. Quaternary

  7. ALDOLASE Aldolase- An enzyme that is used to convert glucose (sugar) into energy. There are three different classifications of Aldolase: A,B, and C Aldolase A: This is mainly found as an embryo. There are very small parts left in the adult tissue. Aldolase B: Is mainly found in the main organisms such as the Kidney, the intestines, and the liver. Aldolase C: This is found in the brain. Each of these play an important role in giving the body the proper energy that is needed.

  8. What uses this protein? The main organisms that use this protein are: Kidneys’ Livers’ The intestines’ And very small in the brain.

  9. Why Did Choose This? I chose this protein because it interested me in how much the body really does need this protein. Besides being in major organisms Aldolase is found all over the body such as in the nervous system. If the Aldolase is increased in your body you can be in physical danger.

  10. Other Important Facts Aldolaseis all over the body, but is mostly found in muscle tissue. When someone has muscle or liver damage the Aldolase level will be raised higher. What Abnormal Results Mean Greater than normal levels of aldolase may be due to: Damage to skeletal muscles Hepatitis Infectious mononucleosis Liver, pancreatic, or prostate cancer Muscular dystrophy Myocardial infarction Polymyositis