EcoRI 1

Aug 31, 2014

10 likes | 98 Views

Tn 5. 749. EcoRI 1. EcoRI 4414. 3145. 1754. clpX. lon2. PP2304. PP2303.

Share Presentation

Embed Code

Link

pp2304
tn 5

hollye

Download Presentation

EcoRI 1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Tn5 749 EcoRI 1 EcoRI 4414 3145 1754 clpX lon2 PP2304 PP2303

1 X 1 X 1 = 1

1 X 1 X 1 = 1. The Trinity. 2 Corinthians 13:14.

692 views • 17 slides

1 2551 1 1

1.1k views • 27 slides

1-1 1-2 1-3 1-4 1-5 1-6

1-1 ? ?. ????????????????,?????????,??????????????,???????????. Aaker(1991)????????????????,??????????; Urde(1994)???????(brand-oriented)???????????????; ??????????????????,???????????????(Duncan T., 1999;??.???, 2000;Jeff Cannon, 2001;Aaker,1991, 1995, 1996, 2000;Keller,1993, 2001). 1-2 ???

357 views • 14 slides

1-1

1-1. Variables and Expressions. Warm Up. Problem of the Day. Lesson Presentation. Course 3. 1-1. Variables and Expressions. Course 3. Warm Up Evaluate. 1. 21  2(3). 15. 2. 4 + 3  9. 31. 3. 2(9) + (3). 21. 4. 6(1.4) + 12. 20.4. 5. 7(2.9)  5 . 15.3. 1-1.

388 views • 18 slides

1 Peter 1:1

1 Peter 1:1. Peter, an apostle of Jesus Christ: To the temporary residents dispersed in Pontus, Galatia, Cappadocia, Asia, and Bithynia. Spiritual leadership. 1 Peter 5:1-7. 1 Peter 5:1.

1.09k views • 55 slides

Oligonucleotides used in this study OsMS45p EcoRI GGGAATTCAGATCAGGAGCGAGGG

Oligonucleotides used in this study OsMS45p EcoRI GGGAATTCAGATCAGGAGCGAGGG OsMS45p RcaI GGTCATGAGGAGATCAGGAGCGAGGG OsMS45p NotI GGCGGCCGCCCTATAACCCAACGCATGCTC OsMS45p HinDIII GGAAGCTTCCCTATAACCCAACGCATGCTC AtMS45p EcoRI GGGAATTCTTAAAAGTGCTTAGAGGTGGACCAG

99 views • 1 slides

1 17 2 20 2 13 1 9 5 1 1 1 1 1 1 1 1 1 17 1 1 11 1 7 1 22 3

Fig. S1. 1 17 2 20 2 13 1 9 5 1 1 1 1 1 1 1 1 1 17 1 1 11 1 7 1 22 3. Qin et al. 2010 scaffold72363 2 MH0006. 58. 55. Ruminococcus sp. SR1/5 (CBL20088). 72. Ruminococcus obeum A2-162 (CBL23218). 48. Qin et al. 2010 scaffold1333 11 O2.UC18. 59.

374 views • 1 slides

1 1 0 1

D0 D7 RD WR A0 A1 CS. We keep sending walking zeros: 111 0 - 11 0 1 - 1 0 11 - 0 111. Now we sense the change by inputting data from Port A. This combination can be used to look up what button this represents i.e. A.

210 views • 1 slides

a 4 ‘ 1 1 0 1 1 0 1 1 1 0 1 1 0 0 1 1 0

0 1. Vote histogram (so far). UF NNC Ptree Ex. 1 using 0-D Ptrees (sequences) a=a 5 a 6 a 1 ’a 2 ’a 3 ’a 4 ’=(000000).

300 views • 15 slides

1 Peter 1:1

1 Peter 1:1. Hope for Today. Pg 1075 In Church Bibles. Peter an apostle Galilean fisherman…followed Jesus Jesus changed name: Simon to Peter  Peter means “rock” Outspoken disciple…sometimes to folly Jesus made him an apostle. Luke 6:13.

1.03k views • 48 slides

1 1 0 0 1 1

1 1 0 0 1 1. 1 1 0 1 0 0. 0 0 0 1 1 0. 1 1 0 0 0 0. 0 0 1 0 1 1. 1 0 0 0 1 0. 0 0 1 1 1 0. 0 0 0 0 0 1. 0 0 1 0 1 0. 1 0 1 1 0 0. 1 0 1 1 1 0. 1 0 1 0 1 0. 0 1 1 1 1 1. 1 0 0 0 0 1. 0 1 1 1 1 0. 1 0 0 1 1 0. 1 1 0 1 0 1. 0 1 1 1 0 1. 0 1 1 1 0 1. 0 0 1 0 0 1. 0 0 1 1 0 1.

399 views • 26 slides

Direct product: e.g. B 1 B 2 = (1 -1 1 -1) (1 -1 -1 1) = (1 1 -1 -1) = A 2

Direct product: e.g. B 1 B 2 = (1 -1 1 -1) (1 -1 -1 1) = (1 1 -1 -1) = A 2. Two-dimensional representations. Constructing molecular orbital diagrams. A 1. B 2. B 1. Only atoms left in place need to be considered. Vectors left unchanged contribute 1 to the character

142 views • 6 slides

1 1 1 1 2 1 1 3 3 1 1 4 6 4 1

1 1 1 1 2 1 1 3 3 1 1 4 6 4 1 1 5 10 10 5 1. 1 1 1 1 2 1 1 3 3 1 1 4 6 4 1 1 5 10 10 5 1. 0 C 0. 1 1 1 1 2 1 1 3 3 1 1 4 6 4 1

337 views • 23 slides

Plazmid emésztése ECoRI , Not I, SalI , BamHI és XhoI enzimekkel

1. 2. 3. 4. 5. 6. 1.:1Kb DNA Ladder Invitrogen 2.: ECoRI-NotI enzimmel 3. : ECoRI enzimmel 4 .: SalI-NotI enzimmel 5 .: SalI enzimmel 6 .: BamHI-XhoI enzimmel. Plazmid emésztése ECoRI , Not I, SalI , BamHI és XhoI enzimekkel. 4072bp 3054bp 2036 b p.

283 views • 1 slides

More Related