540 likes | 980 Views
Human Genetics. Weibin Shi Michele Sale. Contact Information. Shi: ws4v@virginia.edu ; 243-9420 Sale: ms5fe@Virginia.EDU ; 982-0368 . Recommended textbooks. Medical Genetics -Jorde, Carey, Bamshad & White Mosby, ISBN 13: 978-0-323-04035-8 Human Molecular Genetics - Strachan T, Read A
E N D
Human Genetics Weibin Shi Michele Sale
Contact Information • Shi: ws4v@virginia.edu; 243-9420 • Sale: ms5fe@Virginia.EDU; 982-0368
Recommended textbooks • Medical Genetics -Jorde, Carey, Bamshad & White • Mosby, ISBN 13: 978-0-323-04035-8 • Human Molecular Genetics - Strachan T, Read A Garland Science,ISBN-10: 0815341822
Overview of course content • 1: Organization of the human genome • 2: Genetic variation • 3. Patterns of inheritance • 4: Population genetics • 5: linkage disequilibrium • 6: Genetic epidemiology • 7: Applied research in human genetics
Human chromosomes 23 pairs 46 chromosomes 22 pairs – autosomes 1 pair sex chromosomes 46,XY Normal male
Human chromosomes 46,XX Normal female
Human genome = nuclear genome + mitochondrial genome
Mitochondrial genome 16,569 bp 37 genes NUCLEAR GENOME 24 distinct chromosomes (22 autosomal + X + Y) 3,200 Mbp 25,000 genes
Human Mitochondrial Genome Small (16.5 kb) circular DNA rRNA, tRNA and protein encoding genes (37) 1 gene/0.45 kb Very few repeats No introns 93% coding Genes are transcribed as multimeric transcripts Maternal inheritance
What are the mitochondrial genes? • 24 of 37genes are RNA coding • 22 tRNA • 2 ribosomal RNA (23S, 16S) • 13 of 37 genes are protein coding some subunits of respiratory complexes and oxidative phosphorylation enzymes
Limited autonomy of mitochondrial genome mt encoded nuclear NADH dehydrogenase 7 subunits 35 subunits Cytochrome b-c1 comp 1 subunit 10 subunits Cytochrome C oxidase 3 subunits 10 subunits ATP synthase complex 2 subunits 14 subunits
Two overlapping genes encoded by same strand of mt DNA (unique example) Two independent ATG located in Frame-shift to each other, second stop codon is derived from TA + A (from poly-A)
Human Nuclear Genome 3,200 Mb 23 (XX) or 24 (XY) linear chromosomes 25,000 genes 1 gene/120kb Introns in the most of the genes 1.5 % of DNA is coding Genes are transcribed individually Repetitive DNA sequences (45%) Inherited from both parents
Human Nuclear Genome In human nuclear genome gene-rich regions are separated by gene deserts Chr. 19 has the highest gene density Chr. 13 & Y show the lowest gene density
Human genome base content • 41% CG in average 38% CG for Chr. 4 and Chr. 13 49% for Chr. 19 • Regions with wide swings in CG content (e.g. from 33.1% to 59.3%) Gene density correlates with higher CG content
CpG dinucleotide depletion • Expected frequency is 4.2% • Observed frequency is five times lower
Location of CpG islands in the gene CpG islands in the regulatory areas of human genes
Human nuclear genome • Gene density varies widely • Averagely 9 exons per gene • 363 exons in titin gene • Certain genes are intronsless • Largest intron is 800 kb (WWOX gene) • Smallest introns – 10 bp • Average 5’ UTR 0.2-0.3 kb • Average 3’ UTR 0.77 kb • Largest protein: titin: 38,138 aa
Gene density varies substantially between chromosomal regions
INTRONLESS GENES • Interferon genes • Histone genes • Many ribonuclease genes • Heat shock protein genes • Many G-protein coupled receptors • Various neurotransmitters receptors and hormone receptors
Classical gene families: members exhibit a high degree of sequence similarity CS = chorionic somatomammotropin four placenta-specific genes, primates only serum albumin alpha-albumin vitamin D-binding protein
Gene families: gene products bearing short conservative amino acid motifs DEAD box proteins are involved in mRNA splicing and translation initiation; DEAD box (Asp-Glu-Ala-Asp) WD proteins take part in a variety of regulatory functions, GH (Gly-His) should be at 23-41 aa distance from WD (Trp-Aps)
Gene superfamily: Proteins that are functionally related in a general sense, but show only weak homology
Functionally similar genes are occasionally clustered, but usually dispersed throughout the genome
Non-coding RNA genes • Code for functional RNA • ncRNA represent 98% of all transcripts in a mammalian cell • ncRNA can be: • Structural • Catalytic • Regulatory
How many genes in the nuclear genome? ~3000 RNA genes in the nuclear genome ~10% of human gene count have not been taken into account in gene counts
Non-coding RNA • tRNA – transfer RNA: involved in translation • rRNA – ribosomal RNA: structural component of ribosome, where translation takes place • snoRNA – small nucleolar RNA: functional/catalytic in rRNA maturation • Antisense RNA: gene regulation/silencing
microRNA • A new class of non-coding RNA gene • Products are 19~25 nt RNAs • Precursors are 70-100 nt. • Block translation or result in degradation of target mRNA
Satellite DNA is repetitive DNA that could be separated by centrifugation Equilibrium density gradient centrifugation Sheared DNA in Cesium Chloride gradient
Satellite DNA Alpha –satellite (Centromere DNA) Microsatellite Minisatellite
Microsatellite di-, tri-, and tetra-nucleotide repeats ~10% of the nuclear genome TGCCACACACACACACACAGC TGCCACACACACA------GC TGCTCATCATCATCAGC TGCTCATCA------GC TGCTCAGTCAGTCAGTCAGGC TGCTCAGTCAG--------GC
Minisatellites • 6-64 bp repeating pattern 1 tgattggtct ctctgccacc gggagatttc cttatttgga ggtgatggag gatttcagga 61 attttttagg aattttttta atggattacg ggattttagg gttctaggat tttaggatta 121 tggtatttta ggatttactt gattttggga ttttaggatt gagggatttt agggtttcag 181 gatttcggga tttcaggatt ttaagttttc ttgattttat gattttaaga ttttaggatt 241 tacttgattt tgggatttta ggattacggg attttagggt ttcaggattt cgggatttca 301 ggattttaag ttttcttgat tttatgattt taagatttta ggatttactt gattttggga 361 ttttaggatt acgggatttt agggtgctca ctatttatag aactttcatg gtttaacata 421 ctgaatataa atgctctgct gctctcgctg atgtcattgt tctcataata cgttcctttg Repeat: AGGAATTTTT
α-Satellite repeat • 171 bp sequence repeat
Interspersed repetitive DNA • SINE (Short interspersed nuclear elements): • Alu, ~0.3 kb, ~10,7% of human DNA (1,200, 000 copies) • MIR, ~0.13 kb, 3% of human DNA (500,000 copies) • LINE (Long interspersed nuclear elements): • ~0.8 kb, ~21% of human DNA (~1,00,000 copies)
Pseudogenes • Non-functional copy of a gene • Non-processed pseudogene • Nonfunctional copies of the genomic DNA sequence of a gene • Contain exons, intron, and flanking sequences • Processed pseudogene • Nonfunctional copies of the exonic sequences of a gene • Reverse-transcribed from an RNA transcript • No 5’ promoter • No introns • Often includes polyA tail • Both include events that make the gene non-functional • Frameshift • Stop codons • Could be as high as 20-30% of all Genomic sequence predictions could be pseudogene • We assume pseudogenes have no function, but we really don’t know!
Human Genome Organization HUMAN GENOME Nuclear genome 3,200 Mb 25,000 genes Mitochondrial genome 16.5 kb 37 genes Genes and gene- related sequences Extragenic DNA Two rRNA genes 22 tRNA genes 13 polypeptide- encoding genes Unique or moderately repetitive Unique or low copy number Moderate to highly repetitive Coding DNA Noncoding DNA Gene fragments Pseudogenes Introns, untranslated sequences, etc. Interspersed repeats Tandemly repeated