more on translation n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
More on translation PowerPoint Presentation
Download Presentation
More on translation

Loading in 2 Seconds...

play fullscreen
1 / 13

More on translation - PowerPoint PPT Presentation


  • 104 Views
  • Uploaded on

More on translation. How DNA codes proteins. The primary structure of each protein (the sequence of amino acids in the polypeptide chains that make up a protein) is represented as a sequence of codons. Each codon is a triplet of nucleotides. Traditionally, codons are

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

More on translation


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
how dna codes proteins
How DNA codes proteins

The primary structure of each protein (the sequence of

amino acids in the polypeptide chains that make up a

protein) is represented as a sequence of codons. Each

codon is a triplet of nucleotides. Traditionally, codons are

written in the A, G, C, U alphabet of RNA. Most organisms

use the same genetic code, i.e., correspondence between

codons and amino acids.

how dna codes proteins1
How DNA codes proteins

There are 64 potential codons.

Most amino acids can be coded by more than one codon.

Three of the codons are STOP codons. They signal the end

of a coding sequence. One codon (AUG) doubles as a

START, or initiation codon that signals the beginning of a

coding sequence.

url of the day
URL of the day

Codon Usage Database

http://www.kazusa.or.jp/codon/

The frequency of codon usage in various organisms may

be searched at this site.

homework 2 1
Homework 2.1
  • Look up the codon usage table for the following organisms:

- Mycoplasma gallisepticum R

- Haemophilus influenzae PittGG

- Homo sapiens (nuclear genome)

- Homo sapiens (mitochondrial genome)

and use it to calculate the average length of a polypeptide chain in this organism. Be sure to explain the ideas behind your calculations.

reading frames
Reading frames

Suppose we are given the following nucleotide sequence:

5’ … AAGTTTCCGAGCTGACGGGACT… 3’

Provided this is a protein coding region, which amino acids

does it code? Let us see how we could parse the above

sequence.

5’ … AAG TTT CCG AGC TGA CGG GAC T… 3’

which translates into:

... Lys Phe Pro Ser STOP

reading frames1
Reading frames

Alternatively, we could have:

5’ … A AGT TTC CGA GCT GAC GGG ACT … 3’

which translates into:

... Ser Phe Arg Ala Asp Gly Thr …

or:

5’ … AA GTT TCC GAG CTG ACG GGA CT … 3’

which translates into:

… Val Ser Glu Leu Thr Gly ...

more reading frames
More reading frames

But what if the coding is done by the other strand? The

reversecomplement to

5’ … AAGTTTCCGAGCTGACGGGACT… 3’ is:

5’ … AGTCCCGTCAGCTCGGAAACTT … 3’

This can be parsed as:

5’ … AGT CCC GTC AGC TCG GAA ACT T … 3’

which translates into:

... Ser Pro Val Ser Ser Glu Ala …

more reading frames1
More reading frames

Alternatively, we could have:

5’ … A GTC CCG TCA GCT CGG AAA CTT … 3’

which translates into:

... Val Pro Ser Ala Arg Lys Leu …

or:

5’ … AG TCC CGT CAG CTC GGA AAC TT … 3’

which translates into:

… Ser Arg Glu Leu Gly Thr ...

there are six different reading frames
There are six different reading frames

We have seen that each stretch of coding region could be

translated in six different ways into amino acid sequences.

These six different ways of parsing a coding sequence are

called reading frames. If we search the genome for coding

regions of genes, all six reading frames

have to be considered.

open reading frames orf s
Open reading frames (ORF’s)

If an organism does not have introns, each reasonably

long stretch between an initiation codon and a STOP codon

(called an open reading frame, orORF) is potentially the

coding region for a polypeptide chain. (But note that the

initiation codon could also be the codon for methionine!)

In organisms containing introns it is much more difficult to

recognize coding regions. On top of being noncoding

themselves, introns may also introduce frame shifts.

homework 2 2
Homework 2.2

Suppose the nucleotide sequence

5’ … AGGCTTCAAGGGT … 3’

is part of a coding region.

Find its translation in all six reading frames.