1 / 77

From the conception of the PRINS to its coronation

From the conception of the PRINS to its coronation. Régen DROUIN, Geneticist MD, PhD, FACMG, FCCMG. Department of Medical Genetics, CHUS & Department de Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada. Cytogenetics:. - Chromosome Cytogenetics

harlanp
Download Presentation

From the conception of the PRINS to its coronation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. From the conception of the PRINS to its coronation Régen DROUIN, Geneticist MD, PhD, FACMG, FCCMG Department of Medical Genetics, CHUS & Department de Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  2. Cytogenetics: - ChromosomeCytogenetics - InterphaseCytogenetics - Conventional Cytogenetics - Molecular Cytogenetics Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  3. Molecular Cytogenetic Techniques available: • FISH (Fluorescence In Situ Hybridization) • & variants: Q-FISH, express FISH, etc. • - PRINS (PRimed IN Situ labeling) • M-FISH (Multicolor-FISH) or SKY • (spectral Karyotype) • Band-FISH • - CGH (Comparative Genomic Hybridization) Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  4. PRINS PRimed IN Situ labeling Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  5. PRINS: Beginning • PRINS technique was introduced in 1989 by Koch & al.- Dept of Cytogenetics, Société Danoise du Cancer- Aarhus, Danemark • Ref. Koch J, Kolvraa S, Petersen K, Gregersen N, Bolund L, Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA In Situ.Chromosoma 1989;98:259-65 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  6. PRINS: HISTORY • Method described 15 years ago, that was applied to respond to questions regarding the structure of the minute chromosomes in the primate -satellite DNA sequence. • Development and Applications of PRINS (many variants of the technique have been described) • There are more and more targets investigated using PRINS (many species: animals and plants) Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  7. INTRODUCTION • Multi-PRINS and Blocking step, • Dual-color PRINS without blocking step • New strategy for triple-color PRINS • Nucleotids labeled with Bio-dUTP & Dig-dUTP • Omission of blocking step • Creating new color by mixing colors Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  8. Chromatin fiber of packed nucleosomes DNA double helix Extended section of chromosome ‘String-of-beads’ form of chromatin Condensed section of chromosome 10nm 700nm 30nm 300nm 1 400nm 2 nm DNA Condensation and fiber-FISH

  9. A good PRINS method should have: - An extremely high specificity (extremely low background) - A good sensitivity (good hybridization efficiency) - Unambiguous recognition of the hybridization signal Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  10. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  11. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  12. PRINS Annealing Elongation Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada MB

  13. PRINS targets : - Metaphase Chromosomes - Interphase Nuclei - Fixed Tissues - Cells in culture Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  14. METHOD Chromosome banding • Slide preparation and the thermocycler • Add Taq polymerase to the reaction solution • Put the mix solution on the slide + cover slip Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  15. METHOD Add Taq polymerase to the reaction solution Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  16. METHOD Put the mix solution on the slide + cover slip support thermocycler

  17. METHOD Detection & visualisation • Washings post-PRINS • Detection using a labeled antibody • Washing of the antibody + counterstaining • Observation under a fluorescence microscope Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  18. Applications of the PRINS technique: - Identification of chromosomes - Aneuploidy detection - Analysis centromere DNA - Identification of markers Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  19. C o m p a r i s o n o f P R I N S w i t h F I S H i n t h e d e t e c t i o n o f i n t e r p h a s e n u c l e i c a r r y i n g t w o s i g n a l s o f c h r o m o s o m e 8 i n 1 6 c o n t r o l c a s e s 1 2 0 1 0 0 8 0 6 0 4 0 2 0 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4 1 5 1 6 C a s e s Proportions (%) of nuclei carrying two signals of chromosome 8 P R I N S 8 F I S H 8 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  20. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  21. C o m p a r i s o n o f P R I N S w i t h F I S H i n t h e d e t e c t i o n o f i n t e r p h a s e n u c l e i c a r r y i n g t w o s i g n a l s o f c h r o m o s o m e 7 i n 1 6 c o n t r o l c a s e s 1 2 0 1 0 0 8 0 Proportions (%) of nuclei carrying two signals of chromosome 7 6 0 P R I N S 7 4 0 F I S H 7 2 0 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4 1 5 1 6 C a s e s Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  22. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  23. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  24. A B C PRINS 7 FISH 8 PRINS 8 D E F FISH 7 Dual-PRINS 7 (red) and 8 (green) Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  25. The development of molecular cytogenetics such as FISH and PRINS are especially important for the study of hematologic disorders. With these approaches, not only dividing cells, but also non-dividing cells can be studied for chromosome identification. • PRINS technique is a good alternative to FISH to identify chromosomes both in metaphase and in interphase nuclei. Our results showed no significant difference between these two techniques regarding detection sensitivity and specificity. PRINS is more cost-effective, easier and faster than FISH. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  26. System Labeling-chromosome Detection mix 1 Bio- 7 Dig- 8 Bio- 18 Avidin-fluorescein/ Anti-dig-rhodamine 2 Dig- 7 Bio- 8 Dig- 18 Anti-dig-fluorescein/ Avidin-rhodamine • Samples preparation: usual techniques • PRINS reaction and detection solutions for three • chromosome targets: • Triple-PRINS programming: • 1st cycle: 62.5C, 10 min with first label, wash in PBS 2 min • 2nd cycle: 62.5C, 10 min with second label, wash in PBS 2 min • 3rd cycle: 62.5C, 10 min with third label, wash in wash buffer 2 min • Detection, Counterstain and image analysis

  27. Detection system 1a Detection system 2b The results of triple-PRINS using two different labeling orders combined with two different detection systems Labeling order 1st signal 2nd signal 3rd signal 1st signal 2nd signal 3rd signal 1. bio-dig-bioYellow Red Green ambiguous 2. dig-bio-digambiguous Yellow Red Green a: Mix of avidin-fluorescein/anti-dig-rhodamine; b: Mix of anti-dig-fluorescein/avidin-rhodamine. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  28. Primers Name Chromosome Sequence Reference-7 7 GCTTGAAATCTCCACCTGAAATGCCACAGC Koch et al. 19958c 8 CTATCAATAGAAATGTTCAGCACAGTT Pellestor et al. 1996 18c 18 ATGTGTGTCCTCAACTAAAG Pellestor et al. 1995 Xc X GTTCAGCTCTGTGAGTGAAA Pellestor et al. 1995 D599 Y TGGGCTGGAATGGAAAGGAATCGAAAC Speel et al. 1995 D600 Y TCCATTCGATTCCATTTTTTTCGAGAA Speel et al. 1995 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  29. A: bio-dig-bio labeling order with detection system 1 The first PRINS reaction The first PRINS site on chromosome 7 3’ 5’ The second PRINS reaction The second PRINS site on chromosome 8 3’ 5’ The first PRINS site on chromosome 7 3’ 5’ The third PRINS reaction The third PRINS site on chromosome 18 3’ 5’ The second PRINS site on chromosome 8 3’ 5’ The first PRINS site on chromosome 7 3’ 5’ : Chromosome DNA; : dNTP; : Biotin-dUTP; : Digoxigenin-dUTP; 3’ 5’ : The first primer; : The second primer; : The third primer;

  30. B: dig-bio-dig labeling order with detection system 2 The first PRINS reaction The first PRINS site on chromosome 7 3’ 5’ The second PRINS reaction The second PRINS site on chromosome 8 3’ 5’ The first PRINS site on chromosome 7 3’ 5’ The third PRINS reaction The third PRINS site on chromosome 18 3’ 5’ The second PRINS site on chromosome 8 3’ 5’ The first PRINS site on chromosome 7 3’ 5’ : Chromosome DNA; : dNTP; : Biotin-dUTP; : Digoxigenin-dUTP; 3’ 5’ : The first primer; : The second primer; : The third primer.

  31. bio-dig-bio labeling, avidin-fluorescein/ anti-dig-rhodamin detection Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  32. bio-dig-bio labeling, avidin-fluorescein/ anti-dig-rhodamin detection

  33. bio-dig-bio labeling, avidin-fluorescein/ anti-dig-rhodamin detection Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  34. dig-bio-dig labeling, anti-dig-fluorescein/ avidin-rhodamin detection Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  35. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  36. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  37. XY normal <==Multi-PRINS FISH==>

  38. 47,XX,+18 <==Multi-PRINS FISH==>

  39. Main advantages of the PRINS technique: • Semi-automated Protocole because of the use of thermocycler • Simple, reproducible and reliable method • Very good ratio cost benefit • Short duration of the reaction (on the average) • Availability of any primers (automatic synthesizer) • The specificity and small size of the primers (18 à 35 mer) does not generate cross reaction • Specificity of centromeric sequences of chromosomes 13 and 21 • More efficient in some cells with more condensed nuclei: the size of primer is much smaller than the size of the probe thus making it easier to pass the nuclear membrane and hybridize to the target DNA Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  40. Main advantages of the PRINS technique: • Detection of unique intragenic sequences • Very low background because of the absence of labeling directly on the primer and the rapidity of the reaction • Good preservation of the integrity of the chromosome structure due to the short incubation time • Multi-target detection: it is very easy to do multi-color PRINS or combine with FISH to simultaneously detect different chromosomes in the same cells. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  41. CONCLUSIONS • Technique PRINS Powerful technique, simple and universal Represents a very good alternative to FISH • Future Perspectives Detection of fusion genes Detection of female foetal cells using the technique of PRINS-RNA Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  42. Applications of the FISH and PRINS techniques: - Identification of chromosomes - Détection of aneuploïdies - Analysis of centromeric DNA - Identification of marker chromosomes Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  43. A good PRINS method should have: - An extremely high specificity (extremely low background) - A good sensitivity (good hybridization efficiency) - Unambiguous recognition of the hybridization signal Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Sherbrooke, Quebec, Canada

  44. Same nucleus in both panels is shown with the opposite colours Simultaneous FISH analysis using sex chromosome specific probes: the red signal correspond to the X chromosome and the blue signal to the Y chromosome Simultaneous reverse FISH analysis using sex chromosome specific probes: the red signal correspond to the Y chromosome and the blue signal to the X chromosome

  45. FISH technique (LSI-21 probe) combined to PRINS reaction (Y primer sequence) Male fetal cell with 3 copies ofChromosome 21 (red signals) and 1 copy of theY chromosome (green signal)

  46. PRINS technique Male fetal cell with trisomy 18

More Related