1 / 3
Download Presentation

TA Cloning Test of ZeBaTA-Based Agrobacterium tumefaciens Binary Vector

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. A (2) (1) B M 5 1 3 7 8 9 10 11 12 13 14 15 16 17 18 19 20 2 4 6 Supplemental Figure S2. TA cloning test of ZeBaTA-based Agrobacterium tumefaciens binary vector. A, TA cloning test of binary vector pCXUN. (1) Ligation of XcmI-digested pCXUN alone yielded very few colonis; (2) Ligation of XcmI-digested pCXUN with PCR product yielded a large number of colonies. The ligations were carried out in a total volume of 10 μL mixture containing 50 ng of T-vector alone, or with the corresponding volume of PCR product of a rice blast fungus Magnaporth oryzea gene MGG_00194.5 with a standard insert-to-vector molar ratio around 6:1. The ligation reaction mixture was transformed into E. coli strain DH 10B by electroporation. B, Samples of restriction digestion analysis of the randomly selected colonies derived from ligation of XcmI-digested pCXUN with PCR product of MGG_00194.5. All samples (Lanes 1-20) digested by BamHI released one band as expected.

  2. rice miRNA precursor osa-MIR528, figure modified from Warthmann et al., (2008) Vectors pXUN-osaMIR528 and pCXUN-osaMIR528 Ubquitin promoter * * G C C G TGTATGG ACATACC ccdB gene CCATACA GGTATGT XcmI XcmI Tnos Generation of T-vectors by XcmI digestion Ubquitin promoter G C C G Tnos Introduce the amiRNA/amiRNA* by single-step PCR P1 AAAGAGCGAACATGGTCGACCAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTGCCTCTCTGTCGAGCATCTTCGCTCTTTA ATTTCTCGCTTGTACCAGCTGGTCCTCTAAGTCAAACTTCGACCTGAAGTGAAAACGGAGAGACAGCTCGTAGAAGCGAGAAA OsPDS-amiRNA* OsPDS-amiRNA P2 Making plant expression amiRNA construct by TA cloning Ubquitin promoter AAAGAGCGAACATGGTCGACCAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTGCCTCTCTGTCGAGCATCTTCGCTCTTTA ATTTCTCGCTTGTACCAGCTGGTCCTCTAAGTCAAACTTCGACCTGAAGTGAAAACGGAGAGACAGCTCGTAGAAGCGAGAAA G C C G OsPDS-amiRNA* OsPDS-amiRNA Tnos Supplemental Figure S3. Schematic representation of single-step PCR generation of an amiRNA construct for gene silencing in rice. Vectors pXUN-osaMIR528 and pCXUN-osaMIR528 were designed based on a rice miRNA precursor osa-MIR528. A G-to-C and a C-to-G mutations (marked with an asterisk) were introduced to generate the XcmI recognition sites. amiRNA and amiRNA* can be introduced into the osa-MIR528 backbone by single step PCR using the primers containing amiRNA/amiRNA* sequence. The system was evaluated by expression of amiRNA for silencing of PDS gene in rice.

  3. A B Supplemental Figure S4. Predicted Secondary Structure of the Mutated osa-MIR528 stemloop. A, Structure of the original osa-MIR528 stemloop. Structure of the mutated osa-MIR528 stemloop. The secondary structures were predicted using mfold (http://www.bioinfo.rpi.edu/applications/mfold/cgi-bin/rna-form1.cgi). The nucleotides marked in the open boxes are the positions where mutations were made to introduce two XcmI recognition sites.

More Related