hallam
Uploaded by
45 SLIDES
654 VIEWS
450LIKES

Solving Edge-Matching Puzzles Using DNA Computing

DESCRIPTION

Solving Edge-Matching Puzzles Using DNA Computing. Mohammed AlShamrani Department of Computer Science Concordia University March 23, 2011. Solving Edge-Matching Puzzles Using DNA Computing. 1. Solving Edge-Matching Puzzles Using DNA Computing. 1. 2.

1 / 45

Download Presentation

Solving Edge-Matching Puzzles Using DNA Computing

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Solving Edge-Matching Puzzles Using DNA Computing Mohammed AlShamraniDepartment of Computer Science Concordia University March 23, 2011

  2. Solving Edge-Matching Puzzles Using DNA Computing 1

  3. Solving Edge-Matching Puzzles Using DNA Computing 1 2

  4. Solving Edge-Matching Puzzles Using DNA Computing 1 3 2

  5. Solving Edge-Matching Puzzles Using DNA Computing 1 3 2 4

  6. Solving Edge-Matching Puzzles Using DNA Computing

  7. Solving Edge-Matching Puzzles Using DNA Computing

  8. Solving Edge-Matching Puzzles Using DNA Computing

  9. Phosphate Solving Edge-Matching Puzzles Using DNA Computing Sugar (deoxyribose ) Hydrogen bonds

  10. Solving Edge-Matching Puzzles Using DNA Computing = 5’-GACACTCACTGTCA-3’ 3’-CTGTGAGTGACAGT-5’

  11. What we can do with DNA … 1. Synthesis 5’-CCAAGTTGATTGAGAA AAGAGTTATATGGGCT-3’ 5’-TAACTCTTTTCTCAAT-3’ Solving Edge-Matching Puzzles Using DNA Computing 2. Hybridization • pH 3. Ligation …………….. Exponential Growth 4. Replication (PCR)

  12. Solving Edge-Matching Puzzles Using DNA Computing Sd Jj 1 copy Sd 2 copies Sd 8 copies 4 copies

  13. DNA Computing is new perspective Solving Edge-Matching Puzzles Using DNA Computing • If DNA strands are made to represent objects/relations, then new knowledge can result from the application of these operations (synthesis, hyb., ligation, PCR, etc). • This is DNA Computing.

  14. Example: Six degrees of Separation • The claim is that any two people in the world are connected, on average, by 6 people who are connected by the “is-a-friend-of” relation. Solving Edge-Matching Puzzles Using DNA Computing • So you are a friend of X1 who is a friend of X2 … who is a friend of X6 who is a friend of Nelson Mandela.

  15. Example: Six degrees of Separation Solving Edge-Matching Puzzles Using DNA Computing • So you are a friend of X1 who is a friend of X2 … who is a friend of X6 who is a friend of Nelson Mandela. 1. Synthesis 2. Hybridization 5’-TAACTCTTTTCTCAAT-3’ 5’-CCAAGTTGATTGAGAA AAGAGTTATATGGGCT-3’ 3. Ligation Unit Computation

  16. Example: Six degrees of Separation • So you are a friend of X1 who is a friend of X2 … who is a friend of X6 who is a friend of Nelson Mandela. Solving Edge-Matching Puzzles Using DNA Computing 1. Synthesis 2. Hybridization 3. Ligation Replicate sequences that begin with “You” and end with “Nelson Mandela” 4. Replication: Post-Ligation Product

  17. Example: Six degrees of Separation • So you are a friend of X1 who is a friend of X2 … who is a friend of X6 who is a friend of Nelson Mandela. Solving Edge-Matching Puzzles Using DNA Computing Post-Replication product: sequences of different lengths but all begin with you and end with Mandela 1. Synthesis 2. Hybridization 3. Ligation 4. Replication Sequence encoding 6 people between you and Mandela

  18. Example: Six degrees of Separation • So you are a friend of X1 who is a friend of X2 … who is a friend of X6 who is a friend of Nelson Mandela. Solving Edge-Matching Puzzles Using DNA Computing Post-Replication product: sequences of different lengths but all begin with you and end with Mandela 1. Synthesis 2. Hybridization 3. Ligation 4. Replication Sequence encoding 6 people between you and Mandela

  19. Example: Six degrees of Separation • So you are a friend of X1 who is a friend of X2 … who is a friend of X6 who is a friend of Nelson Mandela. Solving Edge-Matching Puzzles Using DNA Computing 1. Synthesis 2. Hybridization 3. Ligation 4. Replication 5. Gel Electrophoresis Your best chance of meeting Mandela Reference ladder

  20. Challenge: pack a collection of square tiles on a square board such that: • All abutting edges match in color • All boundary edges are grey Solving Edge-Matching Puzzles Using DNAComputing

  21. Relevance: • Complexity: EMPs are NP-Complete Solving Edge-Matching Puzzles Using DNAComputing • Turing-universality: 2-Dimensional growth of tiles can simulate the execution of any Turing machine. 14 5 9 • Nanotechnology: Tiles can serve as definitional motifs for nano-technological constructions: given a desired 2D shape, what set of tiles (preferably minimal) can grow to that shape? 5 + 9 = 14

  22. To solve an EMP with DNA, we need to: Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem

  23. Solving Edge-Matching Puzzles Using DNA Computing To solve an EMP with DNA, we need to: 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem

  24. Solving Edge-Matching Puzzles Using DNA Computing To solve an EMP with DNA, we need to: 1. Define the problem 2. Formulate an algorithm 3. Implement a DNA lab protocol Diagonal-wise tile stacking: The algorithm succeeds if it makes a series of correct choices: at each step, find diagonal sets of tiles that can fit legally.

  25. Solving Edge-Matching Puzzles Using DNA Computing To solve an EMP with DNA, we need to: 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Diagonal-wise tile stacking: But couldn’t there be more than “correct” choice at each step? Yes: non-determinism. NP-Complete

  26. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Diagonal-wise tile stacking: Observation: at any given step, only two edges of each tile are involved in constraint validation.

  27. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Diagonal-wise tile stacking: Observation: at any given step, only two edges of each tile are involved in constraint validation Conceptually: a tile is the union of two half tiles.

  28. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Diagonal-wise half-tile stacking: Conceptually: a tile is the union of two half tiles. The algorithm succeeds if it makes a series of correct choices: at each step, find diagonal sets of half-tiles that can fit perfectly.

  29. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Pairs of half-tiles Diagonal-wise half-tile stacking: Tile dissection along the diagonals produces two pairs of half tiles

  30. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem U U U U The union of a pair on the tiling grid reproduces the tile in one orientation Diagonal-wise half-tile stacking:

  31. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Diagonal-wise half-tile stacking: Formalizations What is the relation between half-tiles? Is the solution with the set of half-tiles equivalent to that of tiles? What is the union of two half-tiles? What is the relation (“bridging”) between diagonal sets of half-tiles (“lanes”)? What is a half-tile? Can we proof it? What is a valid lane ?

  32. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Diagonal-wise half-tile stacking: Formalizations

  33. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Why ? 7 half-tiles 5 half-tiles 1 half-tile 3 half-tiles Diagonal-wise half-tile stacking: In the correct solution, diagonal sets of half-tiles have two useful properties: 1. All diagonal sets of half-tiles are of odd length 7 half-tiles 5 half-tiles 3 half-tiles 1 half-tile

  34. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Why ? Diagonal-wise half-tile stacking: In the correct solution, diagonal sets of half-tiles have two useful properties: 1. All diagonal sets of half-tiles are of odd length 2. All diagonal sets of half-tiles are begin and end with “grey”

  35. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Why ? Diagonal-wise half-tile stacking: Gel Electrophoresis as a computational heuristic In the correct solution, diagonal sets of half-tiles have two useful properties: 1. All diagonal sets of half-tiles are of odd length 2. All diagonal sets of half-tiles are begin and end with “grey” Polymerase Chain Reaction (PCR) as a computational heuristic and a processing power

  36. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem DNA Grid Ultimately we seek to find the set of DNA lanes that encode the full solution to the puzzle: 1. Enumerate DNA lanes (“stapling”) 2. Build DNA grid by stacking lanes (“bridging”)

  37. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Step 1: Associate half-tiles to random ssDNA sequences (synthesis) GTAGAAGAGAAATAAG-3’ GAATAAAGCTAGCGGC-3’ 5’-ATGGGTGAAGAAGATG

  38. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Step 2: Mix half-tiles strands with stapler strands to generate random lanes “Blue” staple “Red” staple 3’-TCTTCTACCATCTTCT-5’ 3’-CTTTATTCCTTATTTC-5’ GTAGAAGAGAAATAAG-3’ GAATAAAGCTAGCGGC-3’ 5’-ATGGGTGAAGAAGATG

  39. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Step 3: Keep only lanes of beginning and ending with grey (PCR)

  40. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Step 4: Keep only lanes of length 1, 3, 5, and 7 half-tiles (Gel Electrophoresis).

  41. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Step 5: Bridge lanes. Bridging strands 5’………..XXXXXTGTATATGTGTGGGAACAGGTTTAATXXXXX………3’ • ‘5-ATTAAACCTGTTC • CCACACATATACA-3’ • 5’-TTCTCAATATACT • GAGGACTTTACCT-3’ • 3’-.........XXXXXXAAGAGTTATATGA CTCCTGAAATGGAXXXXX…..5’

  42. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Step 5: Bridge lanes. • Bridging is a sensitive and labor-intensive process: • 3-D shape of the double-helix must be taken into account: design constraints • Migration of bridged assemblies on gel is tricky

  43. Solving Edge-Matching Puzzles Using DNA Computing 2. Formulate an algorithm 3. Implement a DNA lab protocol 1. Define the problem Puzzle Solution =

  44. Solving Edge-Matching Puzzles Using DNA Computing Concluding remarks: • NP-Completeness of EMPs: we can measure processing power of DNA Computing • Half-tile Assembly Model: • Turing-complete • PCR-powered model for DNA nanotechnological fabrication

  45. Solving Edge-Matching Puzzles Using DNA Computing http://users.encs.concordia.ca/~mo_alsha/thesis/

More Related