1 / 1

Hlx1

A. E. Hlx1* (75 bp) + + + + + - + + Induced PRDM9 Cst - + - + + + + - Induced PRDM9 Dom2 - - + - - - - - Induced vector - - - - - - - + Cold competitor - - - Hlx Esr Psmb Pbx -. B. Hlx1. 186,441,806.

grady-yang
Download Presentation

Hlx1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A E Hlx1* (75 bp) + + + + + - + + Induced PRDM9Cst - + - + + + + - Induced PRDM9Dom2 - - + - - - - - Induced vector - - - - - - - + Cold competitor - - - HlxEsrPsmbPbx - B Hlx1 186,441,806 186,439,201 Fraction shifted 0.0 0.35 0.03 0.02 0.06 0.03 0.28 0.01 Hlx1* (75 bp) + + + + + - + + + + - Uninduced PRDM9Cst - + - - - - - - - - - Induced PRDM9Cst - - + + + + - - - - - Hlx1 cold - - - + - - - - + - - Non-competitor DNA - - - - + - - - - + - Uninduced PRDM9Dom2 - - - - - - + - - - - Induced PRDM9Dom2 - - - - - - - + + + + Hlx1* (75 bp) + + + + + + + Induced PRDM9Cst + + + + + + + Competitor (bp) - 30 31 32 33 36 75 Fraction shifted 0.0 0.0 0.34 0.07 0.41 0.0 0.01 0.01 0.01 0.01 0.0 B6 Hlx1*(75 bp) + - CAST Hlx1* (76 bp) - + Induced PRDM9Cst + + C Hlx1(31 bp)C57BL/6J – AGTGTGCAGACTTGGACCCTGCCCTTTCTTT Hlx1(31 bp)CAST/EiJ – AGTGTTCAGACTTGGACTCTGCCCTTCCTTT Inferred motif Fraction shifted 0.66 0.62 0.11 0.12 0.08 0.08 0.05 0.47 0.16 D

More Related