1 / 1

Analysis of PRDM9 Induction Effects on Hlx1 Variants: DNA Competitor Interactions

This study explores the effects of induced and uninduced states of PRDM9 on Hlx1 variants, focusing on competitor interactions in different conditions. We investigate the differential shifting of DNA fractions across induced PRDM9 constructs, including the cold competitor, Hlx1, and other variants. Key metrics, such as the fraction shifted of responsiveness, are analyzed to understand the molecular mechanisms underpinning Hlx1 functionality. Our findings contribute to the broader understanding of gene regulation mechanisms in response to DNA competitors.

grady-yang
Download Presentation

Analysis of PRDM9 Induction Effects on Hlx1 Variants: DNA Competitor Interactions

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. A E Hlx1* (75 bp) + + + + + - + + Induced PRDM9Cst - + - + + + + - Induced PRDM9Dom2 - - + - - - - - Induced vector - - - - - - - + Cold competitor - - - HlxEsrPsmbPbx - B Hlx1 186,441,806 186,439,201 Fraction shifted 0.0 0.35 0.03 0.02 0.06 0.03 0.28 0.01 Hlx1* (75 bp) + + + + + - + + + + - Uninduced PRDM9Cst - + - - - - - - - - - Induced PRDM9Cst - - + + + + - - - - - Hlx1 cold - - - + - - - - + - - Non-competitor DNA - - - - + - - - - + - Uninduced PRDM9Dom2 - - - - - - + - - - - Induced PRDM9Dom2 - - - - - - - + + + + Hlx1* (75 bp) + + + + + + + Induced PRDM9Cst + + + + + + + Competitor (bp) - 30 31 32 33 36 75 Fraction shifted 0.0 0.0 0.34 0.07 0.41 0.0 0.01 0.01 0.01 0.01 0.0 B6 Hlx1*(75 bp) + - CAST Hlx1* (76 bp) - + Induced PRDM9Cst + + C Hlx1(31 bp)C57BL/6J – AGTGTGCAGACTTGGACCCTGCCCTTTCTTT Hlx1(31 bp)CAST/EiJ – AGTGTTCAGACTTGGACTCTGCCCTTCCTTT Inferred motif Fraction shifted 0.66 0.62 0.11 0.12 0.08 0.08 0.05 0.47 0.16 D

More Related