DNA – What is it? - PowerPoint PPT Presentation

golda
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
DNA – What is it? PowerPoint Presentation
Download Presentation
DNA – What is it?

play fullscreen
1 / 15
Download Presentation
DNA – What is it?
66 Views
Download Presentation

DNA – What is it?

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. DNA – What is it?

  2. A Rather Large Molecule That Encodes for Genetic Instruction * Deoxyribonucleic acid ** DNA is a polymerin the nuclei of cells **Made up of monomer subunits called nucleotides * Most of your cells have identical DNA but genes are “turned on” according to what proteins are made *Example: skin cells will not produce proteins for the liver

  3. Nucleotides **DNA Nucleotides float in the cytoplasm and have three parts: The Backbone Nitrogenous base Phosphate group **There are 4 nitrogen-containing bases: Sugar (deoxyribose) *Adenine (A) *Thymine (T) *Cytosine (C) *Guanine (G)

  4. For Simplicity Purposes – A Single Nucleotide A, G,T or C

  5. Nitrogenous Bases Make Up The DNA “Alphabet” – A,G,T,C ALWAYS Pairs With Purines Pyrimidines ALWAYS Pairs With Cytosine (C) Guanine (G) Thymine (T) Adenine (A) ** Make notice that purines have 2 rings and pyrimidines have one. This is what will gives DNA molecules their shape!!

  6. DNA ** All of the rungs of the DNA “ladder “are pairs of nucleotides, coiled into the shape of a double helix!! **Like a spiral staircase **“rungs” are held together by hydrogen bonds Remember base-pairing rules!!! A with T C with G Nucleotides are held together by hydrogen bonds

  7. Structure of DNA’s Nucleotides Proposed by Watson and Crick in 1953

  8. DNA – It’s all in Your Genes

  9. Genes are Found on Chromosomes (We’ll Discuss These a Little Later!)

  10. Genes • Made up of a series of DNA nucleotides • Only the 4 letters of DNA’s “alphabet” • All of your genes make up a genome • There are about 21, 000 genes • About 3.2 billion base pair • It is estimated that in one single human cell, if you uncoiled the double helix, it would be about 6 foot long!

  11. Genes • Can be several hundred to several thousand base-pair long • Some genes carry the instructions to make proteins that give you traits, like eye color, hair color and freckles! • Some genes are regulatory genes that may control other genes • Some genes are promotor genes, sequences of DNA needed to turn genes “on” or “off”

  12. On the Next Slide is an Example of Part of a Code for a Gene and is only one side of the “ladder”

  13. GACAGACAGACAGACAGACGGACATGCTCATATCGACTCAGGAGGTGATCCTGATCAAGAATATATATACTTTATAGGGTCGGAGATGTCTTCTTCACTGCGTTGCACACTTTTGACCAAAATTATAATACCCTCTGCAAGGGTATAAAAATGAAGCTATACTATATAGTTATTATATATATGCAAAGTCTGGACAAAATTTTGTGCCGATCGGGCCACCACTTTCTTTTTGCCCCATAGAATCCAATGCTCCCTGGGACAAAAATTTACAAAATATTCTTGAAAATTGGGTCAATATATCTAATAAATTATAATCCGGCACTATCCAACCTACTTTTATTCCATGAAAAATGCTAGGTTGAAATTGTTTAATATTCAACTTTACAATATGTATATGCGCTTATACACAAATACACATCACATTAAACAAATATGGAATTAAACACTTAAATTTTACATACCTACACTAATAATTTCCATTTTACGTTGTTTTAAAATATCCAGTATAACATTTGAAATCTTACTTTAAAATGTGATATTATTTAGCGCGCCAAAAAGTCAACGTTTCCGATCAACGAACAGCTGACTTGGGGCATTGGGACCAGTGTGATGTCGAAGGAATCTCACATTAATACTCTGCATAAAAAAGGGAAAAAATCTTACGCTGCCAATTATAGGGGCATTTCTAAATTGTCAGCAAGCCTTCTTGAAAAACGAATTACTCCACATTTTAAACACCTTTATAGTTCAATAATATGATCGTGCCAGCATGCCTTCATGAAGAGCCACTCTACCACTACCAACTTTTTGGAGCTAACATCTTTTGTCACGGATGGGTTCCATTTACACTGACTTTAGTTAAGATTTTGACTCTGTTAACCATCCTACATTTTACATTGTGTATTAACGACTTTCCCCTTGTTTTAACCAATTCACTTTTACTTATGTATATCTGCATTATGGATTCACTTGTGCCGAATCTAAACTTCAATCCGATTTGGCCAGATATTAAAATTGGTGTTTTGAAAATAACCTAAGACTTATTGTATGCAACTGTAAATTCGTGTCATTTTATCGATTTAGAGCAGGGATGGCCCTGTTGTTAGATTGCTCTGTCATATGGGAAGAGCAATGTCATATACGTGTGCTGCTCCCAGTATAGGCGATGAAAATTAATAAAAAAAAATTTTGCGTGGCTCAACAACGTTTAACATAGTTTCATAGTTAACTTAACTTCTTTGGTCTGTCCGATATTTAAGTATCGTGTAGTAGAGCCCTCATTATGGAGTAAACCGAGATCACATCGAATCTGTACAAAAAAATTCCTGATTTTCCTGACGATATTTCCAACATACATATATCTAATAATATAAACTGCCAACTAACTGCAAGCCGGTAAATATCAACTTCGCCTCCGCCCGATGTGGAGTTTTCTTTCTTGTTATAATTTGTTTACGTTAGAAATTAAAAAAATAATTTTTTAAAGAAAAAGATGGAAAGCTACAAAGCCACCACAAAGCCGCTTACAGAAAAGTGAAAAAAATTGTAAATGCCGTAAAAATTGAGAATATCAAGATGTCAATCAATGCGCATTCAATATTATAGTGTTATTAAAGATAAAGAAAGAAATACTTTTTTATAGATATGGTGACTATAACTTTCCAAAAATATAGTGAATGAACATTTTAATACTCCTTGAGCACATTAAGGCATGCGATACGACATTTCAATTCTTTCGAACCGAAGCGCATAAGTGCAAAAGGCAACAACCTTAAAAAGTCAACAACCTTGAAAGCAATTTGAATATTTGTATATAAATTAAATGATAAATGCCAAAAAAATATAACTTTGATCCACTTTCAAGAACGCTTTTACTTTTGTTTGATACTGTTTGTTACTAAGTGATTGTAACTAAATGATTCAACAAAAAGATATTAAAATTTCCATATTATAAGGGTGTGTCCAATTTTCGTGTTTTTAGCTTAATTTGAATTTCCAAATTAATTATACATACAAAATACTTACATTATTGCAATTTCTCATCTATTTACATTTCAATGTTAACCAATTCTTGAATTTACATGAAAAAGCCTATTTACACAGTTCACGATTTTAATTACTTTGGATTGTTTGTGGTCAAAGTATTTTAGGTATATTTTTTTGGAATTGATAATAAAGTCAGTTTTGTTGCAACCGCATATATAAACTCACACTCGAGTATTTACGGGTTAGTTGCCAATTGCTTAGCAATTCGTTAATACGCTTTCAATTTATTTAATGTTAACGCCGCAAACATATACACCGTTTTAAACATCAACGACTTTAAATAATTAGAAATTTAACAAAAACTTAAATGGAGATGGCAAAAAATAAGAAATATTCCCGGTCTCTGCCAGAATCAGACGGAGATGATATAGTAATTTCTGGAATGGCCGGAAAATTTCCAAACTGTAGCAACATATCGGAATACGAGTTTAAACTATATAACAAGGTTAGAAACAAAGTTTAAAATAAAACGTCCAATGGGGAAAACCATCTAATAATACTGATATGAAAAAAATTTGGTGAATAAAACATAACAAGAGCATTTTTAAACTGTGAATTGAAATAAAATAGTTGATTAAAAAGAACAGTACGCAGGAAATGGAAAAGTAAAAAACACAAGAAAGAAAAGATAACTTTGGGCGCAGCCTAAGTAGCAGAAATTTCTTGCGACTTGCCCCCAGAGGCCCCAGACAGAATCTCACTTCCCGTCCAATCGACCGAGGGACGCTGCACATAACGTACTCAAATCGTGGGGATAGATCCGAGAAAGTAGGAGTAAGATATCACGACCAAGAGAGTTGCGGATAAGGCGTTTAGTATAAGGGATTTAGAATTGTTAGTGGAGCAAAGGGACAGGATGTGGTAGAGATCATTGTAGTCCGAACATAATACCCTGAACGGATCGTGTTGGGCAAATGTCGAACTACAATGGCTGAAGAGTAGAGGACGAAAGATTCTAGTCCGCCTACTAGGAACGTTAAAATTTAAACGAGTTAGTAAATGCTAGCTGTCTTCATTACCATAAATAGGATTGTATAGAAACATAACGCTTTATTAATGACGGTAAGTTGATTAATAAAAGTCTACTAATATAAGAGAGGAGGTGGAGATTGGCATCCCAATTAAGTCCACTAAGGGCGAAAATCAGGAAATTTTTTTGAACTGATCTCGGTGTACTCCGTATTGAGGACTCCAGTGACACGAATCATTAAATTCTTTTGACCATCTTTTCATAAAACCAAATACACCCATTATTAACCAGTTATATTAACCATGGTGGATGTATGGTTGGTAAATTTAAGTTTCAAATTTAATATGACCTAGATCGTTACCTGAGTTAATCCTTCTAAGGCGTTCCCATAGAGGAAATACATAGCCTAATGATGACTAGATCGATAAAATGACATTAGTTTACATTTCGATCCATTAAGCGTTAGCTTATTTGCTAAACACCAATTTTGAAATTTATTCAAATAGGATTAAAGTCTAGATTGGGGCACCCAAGATGTAGCGCGCAATAAACGCGAGGTAACATTTTTAAAGAAGACACATTGGGTTCTTTAAGATAAGTAGCTCCAAATCCAGATAAGAAGGTCAGTTGGGAATCCCAAAAAAACTGAGTTTTCTTATAAGAAGCGAATTGTTAACAGAGAAAAATCCTTTACTGAAGTCGGTGTAAATGACGTCTGTTTGTAAGCCATTCCGGAACCAATCGTGACAAAAGATGTTAACTCCTATAAGTTGGTAGTTGCGGAGTGGCGCTTCATGAAGCCATGCTGGCACGGAGATATTACTTACAGAATTAACACTCCTCCTCCCTTTCGCAGGGGTCGACGTCAAAATGTACTTACTTGGAAAAAATTTAGAGCTTAAGATCTCCGGCTTTAACCAAGTTTATGTAAAGAACCTAATGTGAGATGCAAAGGAAGAACTATAAGAATACATTTTGGGAAGTTTACTACGTAACCCTGGAGTATTCTGATAGGTAAATGTTAGTAACAAAAATTAATTTTTTCGAATCTGATGAAGATGAGATTAAAGGTTGTTTAGTGGCTGTAACATCTGGCAATTTTACTCATACAGGTTTGGTCATTTTGTTTTTTTTGACGAAAATGTTCTCTGGCCAAGAACAGGCGAAACAAATCGTCTTGAATATCTGCAAGGGCACACGTATACCTGTGCCTGGTGTATGAATATTTAAATTTTGTAATATACACCACCTTTATGTCGGCTTTTGTTTTGGCTTTGATGTTAGCCGATATATCAATCTCAGAAGTATCAGAGGCAAGCTGGGAAATAAAAATGTGTTTCGATGGAGGAACCACCTGCAACAGTTTCGGTGCCGTCGTAACTAGTTCTGCGACATCAGTTCGTACCGGGGGTCCAGACTTTTGATTACCCTGTTCGGACTTCTCAGGGGTCTTGAATTATTGGGTCTGGAATCACTTGAAGCGATGCCAAAAAGGACATATCAGACAATTGCACATTTATTTTGAGATATTCGGAAGCCGAATTTTTCTCAGGTTCGGCCCTTGGGGTTGCCAGAGATATAAGCGGCTGCATAATCGTCGGTAAAAGAGGATTTCTTCGCTTTGGAGACTTATTTAGTAGTTGAAGACTACTAAACCGTATATCGAGCGCACAGAGTTGGTCATTAATTTTACGAAAACCGCTAATCAACTCGTTGAATCCACTTTTAGCACGACAACCGTCACATTACAAGTAGAGACCGGATCTACGTGAAATAGCATCCGGCACACTTAGCGTGTAAAACGTTTTCACACAGTGAAATGAAAAAGGGAGATTAAAGAGAGCGATTAGTGTGGGTTAGTAAACTGCAAAGAATAGAGATAAGAATCTCTATTGAGAGAGAATAGAAGCATAATCGTAAAAGATGAAGAAGCAGAGCAGGGCTATTTTTGAAAGAAAATTAATTAAGTTATTATTTTACCTCCAAATATATCACTGCACACGCGAAGCAATACGGATGTTTGCGAATGCGAAAGTTTGTTTTTATAAATGTAAATAAATAAAAATAAACACTGGATTGTTAGCTAATAAAAGATTTGATAATAACGCACAAAAATCCGCTTTCAGATAAAGAGAGGCTGTCCTTTTCATAAAAAGATTTGTATTTTATCATACGTTTTTAAAAATTAACGCATTTTACCAAATATTATTATAATTATTAATTAATTTTTAACTTTTAAGATAGATATGGTTGACGATGATGAGCGCAGATGGCGTCATTTTAACCCGGAAATACCAAAACGATCTGGAAAAATTAGTGAGCTTGAAAAATTTGATGCAACATTTTTTGGAGTTCATTTTAAGCAAGCTCATACAATGGATCCCCAAACTCGAATTTTGATTGAGACTGCATATGAAGCGGTCATAGATTCCGGAATAAACCCAAAAAGTCTTCGGGGATCAAAAACTGGAGTGTACATTGGATCTTGTATTTCTGAATCAGAAAAAACATGGTTTTATGAAAAAGTTTCATCTGGTGGATTTGGAATAACTGGCTGCAGTCGGGCTATGATGGCTAATAGAATATCTTACTGTTTAGGACTCGAGGGACCTTCTTTTCTATTAGATACTGCATGTTCAAGTTCAATGTACGCGTTGGATAATGCCTTTAGTGCACTTCGAAATGGAGAAATAGATGCAGCAATAATTGGTGGCTCCAACTTACTTCTTCATCCATTTGTGACTCTTCAATTTGCTCGGTAAGCTTTTTGATTTTTTTAAAATTTTATTTCCTAACAAACTTTAAATTCCATAACATCATAGACTCGGCGTACTTGCTCCAGATGGGTTTTGTCGTCCATTCGATAAAAATGCAAGTGGCTATACCAGATCTGAAACTATCAATTGCCTATTTTTGCAACGAAAACGGGATGCAAAGCGTGTGTATGCTAGTGTTGTGTATTCAAAAACTAATTGTGATGGATATAAGCCAGAGGGTATAACGTATCCATCTGGGGTAGTCCAAGAAAAGTTGTTGGAAAATTTCTATAAAGAGATCGAACTTACCCCCTCAGATTTGGGCTATTTAGAGGCTCACAGTACTGGAACTGTAGTTGGTGATCCAGAAGAATGCAAAGCAATAGACAATGTAATTTGTAGCCAAAGACGCGAGCCTTTATTAATTGGATCTGTTAAATCAAATATTGGACATTCCGAAGCTGCATCAGGAATATGCTCACTTGTTAAAGCTTGCTTTGCATTTGAAACTGGCATGATTGCACCGAATATAAATTTTGCAGAAGTAAAACCAATTATTGCACCTCTAGCAGAAGGAAGATTGCTTGTTGTTAAAGATAAAACGCCTCTACCAAAGCCATACATCGGTATAAATTCTTTTGGATTTGGAGGTGCAAATGCACATGCACTTCTGAAAGGTTTTACCAAATCAAAGACAAATTTTGGGATTCCTGAGGATGATGTACCTCGACTTCTTACATGGGCCGGTAGGACAGAAGATGCAGTGCATGAAATTTTTAGCGACATAGAAAAAAGACCCCTAGATGCAGAATTTATCGGACTACTTCAAAATATTCAAGAGGGACAGACAGACAGACAGACGGACATGCTCATATCGACTCAGGAGGTGATCCTGATCAAGAATATATATACTTTATAGGGTCGGAGATGTCTTCTTCACTGCGTTGCACACTTTTGACCAAAATTATAATACCCTCTGCAAGGGTATAAAAATGAAGCTATACTATATAGTTATTATATATATGCAAAGTCTGGACAAAATTTTGTGCCGATCGGGCCACCACTTTCTTTTTGCCCCATAGAATCCAATGCTCCCTGGGACAAAAATTTACAAAATATTCTTGAAAATTGGGTCAATATATCTAATAAATTATAATCCGGCACTATCCAACCTACTTTTATTCCATGAAAAATGCTAGGTTGAAATTGTTTAATATTCAACTTTACAATATGTATATGCGCTTATACACAAATACACATCACATTAAACAAATATGGAATTAAACACTTAAATTTTACATACCTACACTAATAATTTCCATTTTACGTTGTTTTAAAATATCCAGTATAACATTTGAAATCTTACTTTAAAATGTGATATTATTTAGCGCGCCAAAAAGTCAACGTTTCCGATCAACGAACAGCTGACTTGGGGCATTGGGACCAGTGTGATGTCGAAGGAATCTCACATTAATACTCTGCATAAAAAAGGGAAAAAATCTTACGCTGCCAATTATAGGGGCATTTCTAAATTGTCAGCAAGCCTTCTTGAAAAACGAATTACTCCACATTTTAAACACCTTTATAGTTCAATAATATGATCGTGCCAGCATGCCTTCATGAAGAGCCACTCTACCACTACCAACTTTTTGGAGCTAACATCTTTTGTCACGGATGGGTTCCATTTACACTGACTTTAGTTAAGATTTTGACTCTGTTAACCATCCTACATTTTACATTGTGTATTAACGACTTTCCCCTTGTTTTAACCAATTCACTTTTACTTATGTATATCTGCATTATGGATTCACTTGTGCCGAATCTAAACTTCAATCCGATTTGGCCAGATATTAAAATTGGTGTTTTGAAAATAACCTAAGACTTATTGTATGCAACTGTAAATTCGTGTCATTTTATCGATTTAGAGCAGGGATGGCCCTGTTGTTAGATTGCTCTGTCATATGGGAAGAGCAATGTCATATACGTGTGCTGCTCCCAGTATAGGCGATGAAAATTAATAAAAAAAAATTTTGCGTGGCTCAACAACGTTTAACATAGTTTCATAGTTAACTTAACTTCTTTGGTCTGTCCGATATTTAAGTATCGTGTAGTAGAGCCCTCATTATGGAGTAAACCGAGATCACATCGAATCTGTACAAAAAAATTCCTGATTTTCCTGACGATATTTCCAACATACATATATCTAATAATATAAACTGCCAACTAACTGCAAGCCGGTAAATATCAACTTCGCCTCCGCCCGATGTGGAGTTTTCTTTCTTGTTATAATTTGTTTACGTTAGAAATTAAAAAAATAATTTTTTAAAGAAAAAGATGGAAAGCTACAAAGCCACCACAAAGCCGCTTACAGAAAAGTGAAAAAAATTGTAAATGCCGTAAAAATTGAGAATATCAAGATGTCAATCAATGCGCATTCAATATTATAGTGTTATTAAAGATAAAGAAAGAAATACTTTTTTATAGATATGGTGACTATAACTTTCCAAAAATATAGTGAATGAACATTTTAATACTCCTTGAGCACATTAAGGCATGCGATACGACATTTCAATTCTTTCGAACCGAAGCGCATAAGTGCAAAAGGCAACAACCTTAAAAAGTCAACAACCTTGAAAGCAATTTGAATATTTGTATATAAATTAAATGATAAATGCCAAAAAAATATAACTTTGATCCACTTTCAAGAACGCTTTTACTTTTGTTTGATACTGTTTGTTACTAAGTGATTGTAACTAAATGATTCAACAAAAAGATATTAAAATTTCCATATTATAAGGGTGTGTCCAATTTTCGTGTTTTTAGCTTAATTTGAATTTCCAAATTAATTATACATACAAAATACTTACATTATTGCAATTTCTCATCTATTTACATTTCAATGTTAACCAATTCTTGAATTTACATGAAAAAGCCTATTTACACAGTTCACGATTTTAATTACTTTGGATTGTTTGTGGTCAAAGTATTTTAGGTATATTTTTTTGGAATTGATAATAAAGTCAGTTTTGTTGCAACCGCATATATAAACTCACACTCGAGTATTTACGGGTTAGTTGCCAATTGCTTAGCAATTCGTTAATACGCTTTCAATTTATTTAATGTTAACGCCGCAAACATATACACCGTTTTAAACATCAACGACTTTAAATAATTAGAAATTTAACAAAAACTTAAATGGAGATGGCAAAAAATAAGAAATATTCCCGGTCTCTGCCAGAATCAGACGGAGATGATATAGTAATTTCTGGAATGGCCGGAAAATTTCCAAACTGTAGCAACATATCGGAATACGAGTTTAAACTATATAACAAGGTTAGAAACAAAGTTTAAAATAAAACGTCCAATGGGGAAAACCATCTAATAATACTGATATGAAAAAAATTTGGTGAATAAAACATAACAAGAGCATTTTTAAACTGTGAATTGAAATAAAATAGTTGATTAAAAAGAACAGTACGCAGGAAATGGAAAAGTAAAAAACACAAGAAAGAAAAGATAACTTTGGGCGCAGCCTAAGTAGCAGAAATTTCTTGCGACTTGCCCCCAGAGGCCCCAGACAGAATCTCACTTCCCGTCCAATCGACCGAGGGACGCTGCACATAACGTACTCAAATCGTGGGGATAGATCCGAGAAAGTAGGAGTAAGATATCACGACCAAGAGAGTTGCGGATAAGGCGTTTAGTATAAGGGATTTAGAATTGTTAGTGGAGCAAAGGGACAGGATGTGGTAGAGATCATTGTAGTCCGAACATAATACCCTGAACGGATCGTGTTGGGCAAATGTCGAACTACAATGGCTGAAGAGTAGAGGACGAAAGATTCTAGTCCGCCTACTAGGAACGTTAAAATTTAAACGAGTTAGTAAATGCTAGCTGTCTTCATTACCATAAATAGGATTGTATAGAAACATAACGCTTTATTAATGACGGTAAGTTGATTAATAAAAGTCTACTAATATAAGAGAGGAGGTGGAGATTGGCATCCCAATTAAGTCCACTAAGGGCGAAAATCAGGAAATTTTTTTGAACTGATCTCGGTGTACTCCGTATTGAGGACTCCAGTGACACGAATCATTAAATTCTTTTGACCATCTTTTCATAAAACCAAATACACCCATTATTAACCAGTTATATTAACCATGGTGGATGTATGGTTGGTAAATTTAAGTTTCAAATTTAATATGACCTAGATCGTTACCTGAGTTAATCCTTCTAAGGCGTTCCCATAGAGGAAATACATAGCCTAATGATGACTAGATCGATAAAATGACATTAGTTTACATTTCGATCCATTAAGCGTTAGCTTATTTGCTAAACACCAATTTTGAAATTTATTCAAATAGGATTAAAGTCTAGATTGGGGCACCCAAGATGTAGCGCGCAATAAACGCGAGGTAACATTTTTAAAGAAGACACATTGGGTTCTTTAAGATAAGTAGCTCCAAATCCAGATAAGAAGGTCAGTTGGGAATCCCAAAAAAACTGAGTTTTCTTATAAGAAGCGAATTGTTAACAGAGAAAAATCCTTTACTGAAGTCGGTGTAAATGACGTCTGTTTGTAAGCCATTCCGGAACCAATCGTGACAAAAGATGTTAACTCCTATAAGTTGGTAGTTGCGGAGTGGCGCTTCATGAAGCCATGCTGGCACGGAGATATTACTTACAGAATTAACACTCCTCCTCCCTTTCGCAGGGGTCGACGTCAAAATGTACTTACTTGGAAAAAATTTAGAGCTTAAGATCTCCGGCTTTAACCAAGTTTATGTAAAGAACCTAATGTGAGATGCAAAGGAAGAACTATAAGAATACATTTTGGGAAGTTTACTACGTAACCCTGGAGTATTCTGATAGGTAAATGTTAGTAACAAAAATTAATTTTTTCGAATCTGATGAAGATGAGATTAAAGGTTGTTTAGTGGCTGTAACATCTGGCAATTTTACTCATACAGGTTTGGTCATTTTGTTTTTTTTGACGAAAATGTTCTCTGGCCAAGAACAGGCGAAACAAATCGTCTTGAATATCTGCAAGGGCACACGTATACCTGTGCCTGGTGTATGAATATTTAAATTTTGTAATATACACCACCTTTATGTCGGCTTTTGTTTTGGCTTTGATGTTAGCCGATATATCAATCTCAGAAGTATCAGAGGCAAGCTGGGAAATAAAAATGTGTTTCGATGGAGGAACCACCTGCAACAGTTTCGGTGCCGTCGTAACTAGTTCTGCGACATCAGTTCGTACCGGGGGTCCAGACTTTTGATTACCCTGTTCGGACTTCTCAGGGGTCTTGAATTATTGGGTCTGGAATCACTTGAAGCGATGCCAAAAAGGACATATCAGACAATTGCACATTTATTTTGAGATATTCGGAAGCCGAATTTTTCTCAGGTTCGGCCCTTGGGGTTGCCAGAGATATAAGCGGCTGCATAATCGTCGGTAAAAGAGGATTTCTTCGCTTTGGAGACTTATTTAGTAGTTGAAGACTACTAAACCGTATATCGAGCGCACAGAGTTGGTCATTAATTTTACGAAAACCGCTAATCAACTCGTTGAATCCACTTTTAGCACGACAACCGTCACATTACAAGTAGAGACCGGATCTACGTGAAATAGCATCCGGCACACTTAGCGTGTAAAACGTTTTCACACAGTGAAATGAAAAAGGGAGATTAAAGAGAGCGATTAGTGTGGGTTAGTAAACTGCAAAGAATAGAGATAAGAATCTCTATTGAGAGAGAATAGAAGCATAATCGTAAAAGATGAAGAAGCAGAGCAGGGCTATTTTTGAAAGAAAATTAATTAAGTTATTATTTTACCTCCAAATATATCACTGCACACGCGAAGCAATACGGATGTTTGCGAATGCGAAAGTTTGTTTTTATAAATGTAAATAAATAAAAATAAACACTGGATTGTTAGCTAATAAAAGATTTGATAATAACGCACAAAAATCCGCTTTCAGATAAAGAGAGGCTGTCCTTTTCATAAAAAGATTTGTATTTTATCATACGTTTTTAAAAATTAACGCATTTTACCAAATATTATTATAATTATTAATTAATTTTTAACTTTTAAGATAGATATGGTTGACGATGATGAGCGCAGATGGCGTCATTTTAACCCGGAAATACCAAAACGATCTGGAAAAATTAGTGAGCTTGAAAAATTTGATGCAACATTTTTTGGAGTTCATTTTAAGCAAGCTCATACAATGGATCCCCAAACTCGAATTTTGATTGAGACTGCATATGAAGCGGTCATAGATTCCGGAATAAACCCAAAAAGTCTTCGGGGATCAAAAACTGGAGTGTACATTGGATCTTGTATTTCTGAATCAGAAAAAACATGGTTTTATGAAAAAGTTTCATCTGGTGGATTTGGAATAACTGGCTGCAGTCGGGCTATGATGGCTAATAGAATATCTTACTGTTTAGGACTCGAGGGACCTTCTTTTCTATTAGATACTGCATGTTCAAGTTCAATGTACGCGTTGGATAATGCCTTTAGTGCACTTCGAAATGGAGAAATAGATGCAGCAATAATTGGTGGCTCCAACTTACTTCTTCATCCATTTGTGACTCTTCAATTTGCTCGGTAAGCTTTTTGATTTTTTTAAAATTTTATTTCCTAACAAACTTTAAATTCCATAACATCATAGACTCGGCGTACTTGCTCCAGATGGGTTTTGTCGTCCATTCGATAAAAATGCAAGTGGCTATACCAGATCTGAAACTATCAATTGCCTATTTTTGCAACGAAAACGGGATGCAAAGCGTGTGTATGCTAGTGTTGTGTATTCAAAAACTAATTGTGATGGATATAAGCCAGAGGGTATAACGTATCCATCTGGGGTAGTCCAAGAAAAGTTGTTGGAAAATTTCTATAAAGAGATCGAACTTACCCCCTCAGATTTGGGCTATTTAGAGGCTCACAGTACTGGAACTGTAGTTGGTGATCCAGAAGAATGCAAAGCAATAGACAATGTAATTTGTAGCCAAAGACGCGAGCCTTTATTAATTGGATCTGTTAAATCAAATATTGGACATTCCGAAGCTGCATCAGGAATATGCTCACTTGTTAAAGCTTGCTTTGCATTTGAAACTGGCATGATTGCACCGAATATAAATTTTGCAGAAGTAAAACCAATTATTGCACCTCTAGCAGAAGGAAGATTGCTTGTTGTTAAAGATAAAACGCCTCTACCAAAGCCATACATCGGTATAAATTCTTTTGGATTTGGAGGTGCAAATGCACATGCACTTCTGAAAGGTTTTACCAAATCAAAGACAAATTTTGGGATTCCTGAGGATGATGTACCTCGACTTCTTACATGGGCCGGTAGGACAGAAGATGCAGTGCATGAAATTTTTAGCGACATAGAAAAAAGACCCCTAGATGCAGAATTTATCGGACTACTTCAAAATATTCAAGAGG

  14. Let’s Make A DNA Molecule !!!Beads and Demo